The right answer is As light strikes the tang, all colors of light except blue are absorbed.
The color of the objects around us depends on the light they scatter.
Reminder: during the diffusion phenomenon, an object receives light and sends back a part in all directions.
During the diffusion, part of the white light received is absorbed while the other is returned and gives its color to the object:
A red object absorbs all the colors of white light, except red, a green object absorbs all the lights except green, and so on.
Enlightened by a white light, an object has the color of the light that it does not absorb.
The _____ body cavity is where the nerves of the spinal cord are located.
The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle
If ur doing studyisland the answer is (A) lithosphere
The __________ skeleton is made up of 126 bones of the limbs and girdles.
The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.
What does it mean when we describe water as being polar?
Nutrients move through ecosystems in different way. which nutrient cycles through organisms,rivers,
why are temperatures near the great lakes cooler in the summer than temperatures a few miles away?
EARTH SCIENCE
Answer:the lakes have a high specific heat capacity
Explanation: ape x
What is one major impact of seedless vascular plants?
The vascular seedless plants are utilized as the medicinal plant and fertilizer.
Further Explanation:
The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.
The characteristics of Pteridophytes:
1. They are seedless and vascular cryptogams: They reproduces through the production of spores.
2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.
3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.
4. Sex organs are multicellular and are jacketed.
Some of the example of Pteridophytes are:
1. Equisetum
2. Salvinia
3. Dicksonia
4. Selaginella
The importance of pteridophytes:
1. They are used as cattle feed
2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.
3. Marsilea contains starch and are consumed by people as food in some areas.
4. Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.
Learn more:
1. Learn more about plant https://brainly.com/question/862697
2. Learn more about photosynthesis https://brainly.com/question/873199
3. Learn more about food https://brainly.com/question/1251757
Answer Details:
Grade: College Biology
Subject: Biology
Chapter: The Plant Kingdom
Keywords:
Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.
We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different
Final answer:
Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.
Explanation:
Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.
Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.
What is the hallmark of our species, according to evolutionary psychologists?
Human growth hormone is a secreted protein that stimulates growth and cell reproduction. in the 1960s it was discovered that this was an effective treatment for a form of dwarfism. however, before it was genetically engineered, it was _____
The answer is that it was harvested from cadavers which are corpses of a body that is deceased—they are used before the treatment that is effective for dwarfism was genetically engineered and by this, there has been some studies and researches that has been found out when they harvested from the cadavers.
Living organisms are composed of millions of organic compounds, each having a unique structure . What element is responsible for this huge diversity of molecules? Describe the diversty of structures that can be formed in the properties of this element that allow this diversity of form to occur
Suppose an organism can alternate between aerobic and anaerobic respiration. if it had to use anaerobic respiration exclusively, how many glucose molecules must it break down to generate the same atp as it would in aerobic respiration?
Which of the following pairs with uracil in RNA?
adenine
thymine
guanine
cytosine
RNA is single stranded AND found mainly in the nucleus.
True
False
Which of the following is NOT true?
DNA is found in the nucleus.
DNA replication produces four new strands of DNA.
DNA and RNA each contain four nitrogenous bases.
A nucleotide consists of a sugar, a base, and a phosphate.
Meiosis is the type of cell division which produces haploid gametes. false or true
A student using a light microscope observes a cell and correctly decided that it is
The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?
Which trigonometric functions have asymptotes? (select all that apply.)?
Choose the factor that is likely to limit population growth.
Limiting factors are the resources that can limit population growth. It can include keystone species, predator, energy, available space, disease and food supply etc.
What are the limiting factors for population growth?Population growth limiting factors are either density-dependent or density-independent.
Density dependent factors can include disease, competition and predators while density independent factors can include harsh weather, limited food supply, lower quantity of nutrients etc.
Thus, in the given question, option D is correct.
For more information about population growth, visit:
https://brainly.com/question/18415071
Which of the following is generally true of female bones in relationship to male bones?
They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.
How would earth's atmosphere change if plants stopped carrying out photosynthesis?
Where do the adp and nadh go after they are used in the calvin cycle?
What is the name of muscle's state of perpetual partial tension?
Muscle tone, or tonus, is the state of perpetual partial tension in muscles. It allows muscles to maintain posture and readiness for action, while muscle tension can vary to handle different levels of load.
The name of the muscle's state of perpetual partial tension is muscle tone or tonus. This state helps to maintain posture and ensures that muscles are ready for action. The control of muscle tension involves neural control that initiates the formation of actin-myosin cross-bridges. The tension a muscle produces can vary, allowing it to handle different levels of load, from light objects to heavy objects. During an isotonic contraction, tension in the muscle remains constant as the muscle changes length. Factors like the cross-sectional area of the muscle fiber and the frequency of neural stimulation influence the amount of tension produced.
What is the basic structural unit of both dna and rna?
Which set of body parts does every mollusk have?
The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.
The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.
Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.
How do the atoms in diagram differ from those in diagram d
The processes of endocytosis and exocytosis both require?
Answer: Uses vesicles
How does carbon’s high valence relate to its ability to form these large and complex biomolecules?
Carbon’s high valence is vital in the formation of biomolecules due to the flexibility of carbon which enables its conformity to different shapes.
In the outermost shell of carbon, there are four electrons that enables it form covalent bond with other elements. The atoms of carbon are known to be the backbone of the important molecules that we have in our body.
In conclusion, the flexibility of carbon plays a vital role in the formation of complex biomolecules.
Read related link on:
https://brainly.com/question/4767114
The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.
What are restriction enzymes?A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.
Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.
Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.
Learn more about restriction enzymes:
https://brainly.com/question/14953274
#SPJ6
The circulatory system of organisms carries nutrients throughout that organism. Which cell structure has a similiar structure?