A client who had an organ transplant is receiving cyclosporine. the nurse should monitor for what serious adverse effect of cyclosporine? hirsutism constipation dysrhythmias increased creatinine level

Answers

Answer 1
Answer: hirsutism and increased creatinine levels.

hirsutism and increased creatinine levels are both common side effects of taking cyclosporine. Cyclosporine lowers the body's immune system so that when there is a organ transplant, the immune system doesn't rejects the organ.

Related Questions

What has uekaryotik cells liver, virus, oak, lactobacillus?

Answers

Eukaryotic cells have chromosomes, a membrane-bound nucleus, and membrane-bound organelles, practically any living thing. Eukaryotic cells are also considered animal cells. 

It could be both liver and oak
It could also just be liver if it specifies eukaryotic animal cells. 

Which of the following is generally true of female bones in relationship to male bones?

They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.

Answers

The are actually smoother!
b becuse there female ..........hope it helps

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

dge78wdgqwe8fguefuqefioequf9be

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6

A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False

Answers

False

In order to happen sexual reproduction, the cells that origin gametes must have an even number of chromosomes. By crossing a tetraploid (4n) with a diploid (2n), the offspring would have a total number of 3 copies of each chromosome (2 from the tetraploid parent and 1 from the diploid parent), which when undergoing sexual reproduction would not allow meiosis to happen because the chromosomes could not be evenly divided to gamete cells.

The nurse is used to working on the postpartum floor taking care of women who have had normal vaginal births. today, however, the nurse has been assigned to help care for women who are less than 24 hours post cesarean birth. the nurse realizes that some areas will not be assessed. what would the nurse leave out of the client assessments

Answers

The answer is perineum, usually a woman who experiences cesarean birth does not have an episiotomy though seldom this may be the case. In addition, perineum is the area among the anus and the scrotum in the male and among the anus and the vulva the labial opening to the vagina in the female. An episiotomy is a surgical process to expand the outlet of the birth canal to ease delivery of the baby and evade a sharp rip of the perineum.

The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.

Answers

Generally the ear, and more specifically the cochlea

The ear is composed of 3 parts namely:
 1. The outer ("external") ear, composed of the pinna and ear canal, 
 2. The middle ear, composed of tympanic cavity and three ossicles, 
 3. The inner ear, composed of semicircular canals, the utricle, saccule, and the cochlea. 

Hearing happens initially by allowing the pinna of your ear to focus the sound. Then, by means of the ear canal and the ossicles, the sound is sent to the fluid-filled eardrum, which begins to vibrate. The vibrations are sent to the snail-shell looking component of the inner ear called the cochlea. The cochlea senses these vibrations and converts them to nerve impulses to be interpreted by the brain, making you "hear" the sound. 




why are temperatures near the great lakes cooler in the summer than temperatures a few miles away?


EARTH SCIENCE

Answers

Because water has high special heat capacity

Answer:the lakes have a high specific heat capacity

Explanation: ape x

What is one major impact of seedless vascular plants?

Answers

By far the greatest impact of seedless vascular plants on human life, however, comes from their extinct progenitors. The tall club mosses, horsetails, and tree-like ferns that flourished in the swampy forests of the Carboniferous period gave rise to large deposits of coal throughout the world.

The vascular seedless plants are utilized as the medicinal plant and fertilizer.

Further Explanation:

The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.

The characteristics of Pteridophytes:

1. They are seedless and vascular cryptogams: They reproduces through the production of spores.

2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.

3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.

4. Sex organs are multicellular and are jacketed.

Some of the example of Pteridophytes are:

1. Equisetum

2. Salvinia

3. Dicksonia

4. Selaginella

The importance of pteridophytes:

1. They are used as cattle feed

2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.

3. Marsilea contains starch and are consumed by people as food in some areas.

4.  Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.

Learn more:

1. Learn more about plant https://brainly.com/question/862697

2. Learn more about photosynthesis https://brainly.com/question/873199

3. Learn more about food https://brainly.com/question/1251757

Answer Details:

Grade: College Biology

Subject: Biology

Chapter: The Plant Kingdom

Keywords:

Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.

Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought hit the region and the vegetation dried up. Over time, grasses were observed in the region. Shortly thereafter, an increase in short-necked tortoises was observed in the region. What does this change in the species of tortoises suggest?

Answers

Answer:

A.  

Changes in the environment give rise to evolution of species.

Explanation:

I just did this on PLATO and I got 100%

Final answer:

The change in the species of tortoises suggests natural selection, where tortoises with shorter necks became more abundant in a region with grasses after a drought.

Explanation:

This change in the species of tortoises suggests natural selection at play. In the given scenario, tortoises with long necks were more abundant in regions with higher-level vegetation. This is because their longer necks allowed them to reach and access more leaves for food. However, when a drought hit the region and the vegetation dried up, grasses started to grow. As a result, short-necked tortoises had an advantage as they could easily access the grasses. Over time, these short-necked tortoises became more prevalent in the region.

We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different

Answers

Hormones are the chemical messengers of the endocrine system and are transported by blood to distal target cells.Neurotransmitters are the chemical messengers found in the nervous system that specifically do the transmission across the synaptic cleft, where the space exists between two axons.They both carry messages but belong to different systems of the body.

Final answer:

Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.

Explanation:

Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.

Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.

Human growth hormone is a secreted protein that stimulates growth and cell reproduction. in the 1960s it was discovered that this was an effective treatment for a form of dwarfism. however, before it was genetically engineered, it was _____

Answers

The answer is that it was harvested from cadavers which are corpses of a body that is deceased—they are used before the treatment that is effective for dwarfism was genetically engineered and by this, there has been some studies and researches that has been found out when they harvested from the cadavers.

Which trigonometric functions have asymptotes? (select all that apply.)?

Answers

The trigonometric functions that have asymptotes are:
1. Tangent function 
 f(x) = tan (x)
2. cotangent function
f(x) = cot (x)
3. secant  function
f(x) = sec (x)
4. cosecant function 
f(x) = csc (x)

Suppose an organism can alternate between aerobic and anaerobic respiration. if it had to use anaerobic respiration exclusively, how many glucose molecules must it break down to generate the same atp as it would in aerobic respiration?

Answers

When one glucose is broken down under aerobic condition, 38 ATP are normally produced. When one molecule of glucose is broken down under anaerobic condition, 2 ATP are always produced.
If the organism is using aerobic respiration, it will generate 38 ATP. Under anaerobic condition, the organism have to break down 19 glucose molecules in order to produce 38 ATP, since it can only get 2 ATP from each glucose molecule.

What is the hallmark of our species, according to evolutionary psychologists?

Answers

The hallmark of our species, according to evolutionary psychologists is OUR ENORMOUS CAPACITY AND OUR SHARED BIOLOGY ENABLED OUR DEVELOPED DIVERSITY.
Evolutionary psychology is the study of the root of behavior and mental processes using the process of natural selection and focusing on what make human beings alike. Evolutionary psychologist believed that human beings are so very much alike because they have the same biological make up and high capacity.

The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle

Answers

Hi Ash, thanks for asking a question here on Brainly!

The hard and brittle outer layer of the Earth is known as the lithosphere.

Answer: Letter B 

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or post another question and send the link to me. -UnicornFudge aka Nadia 

If ur doing studyisland the answer is (A) lithosphere

similarities between outer planets and inner planets

Answers

the outer planets are big and cold but the inner planets have more warmth and in earths case LIFE

What does it mean when we describe water as being polar?

Answers

Water is polar because one side negatively charged and one side is positively charged. 
Water is polar because it's polar.

What is the name of muscle's state of perpetual partial tension?

Answers

In healthy humans, our muscles are always a little bit tensed, or in a state of perpetual partial tension. This is called muscle tone. It keeps the bones and joints stable, and prevents muscles that are not being actively used from beginning to atrophy. This is not a conscious process; we don't think about keeping muscles partly active, the body just does it.

Muscle tone, or tonus, is the state of perpetual partial tension in muscles. It allows muscles to maintain posture and readiness for action, while muscle tension can vary to handle different levels of load.

The name of the muscle's state of perpetual partial tension is muscle tone or tonus. This state helps to maintain posture and ensures that muscles are ready for action. The control of muscle tension involves neural control that initiates the formation of actin-myosin cross-bridges. The tension a muscle produces can vary, allowing it to handle different levels of load, from light objects to heavy objects. During an isotonic contraction, tension in the muscle remains constant as the muscle changes length. Factors like the cross-sectional area of the muscle fiber and the frequency of neural stimulation influence the amount of tension produced.

The __________ skeleton is made up of 126 bones of the limbs and girdles.

Answers

Human body skeleton

Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.

Answers

Is a hormone produced by the pancreas

How would earth's atmosphere change if plants stopped carrying out photosynthesis?

Answers

the plant would no longer put out oxygen, and the concentration of carbon.
the atmosphere would no longer have oxygen and carbon. 

Which set of body parts does every mollusk have?

Answers

Hello!

A mollusk is a snail in case you didn't know! Every single one has a foot, a Visceral Mass, and a head. A Visceral mass is like the body and it includes the organs.

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy.

The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.

The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.

Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.

The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?

Answers

The statement that the nurse best response in the client who has diagnose with type 2 diabetes mellitus eats a lot of pasta products is "Pasta can be a part of your diet. It's included in the bread and cereal exchange." So the nurse may say that pasta should be part of the client diet because it includes in the bread and cereal exchange.

The _____ body cavity is where the nerves of the spinal cord are located.

Answers

I believe it would be the dorsal body cavity. 

Hope this helped!

The fitt principle is applied to physical activity and exercise. what does fitt represent

Answers

Frequency, Intensity, Time, and Type.
Final answer:

The FITT principle represents Frequency, Intensity, Time, and Type, which are guidelines for creating an effective physical exercise program to enhance physical fitness and good health.

Explanation:

The FITT principle is a set of guidelines that can help you structure a physical exercise program effectively. FITT stands for Frequency, Intensity, Time, and Type:

Frequency refers to how often you engage in physical activity or exercise.Intensity indicates how hard you exercise during a workout session.Time refers to the duration of each exercise session.Type means the kind of exercise you do to improve or maintain physical fitness and overall good health.

Employing the FITT principle helps ensure that the workouts you perform are balanced and cover all aspects necessary for a comprehensive fitness program. This can include a combination of cardiovascular exercises, strength training, and flexibility workouts.

Identify the medical term referring to a (head) cold:

Answers

The medical term referring to a head cold is coryza. The coryza occurs when an individual’s mucous membranes in their nasal cavity has a presence of inflammation in which will likely result into having a hay fever or causing a person to have a cold.

Final answer:

The medical term referring to a (head) cold is rhinorrhea, which is the excessive production of mucus in response to a viral infection. It is a common symptom of a cold and is often accompanied by sneezing, congestion, sore throat, and coughing.

Explanation:

The medical term referring to a (head) cold is rhinorrhea. Rhinorrhea is the medical term for a runny nose, which is a common symptom of a cold. It occurs when the nasal tissues produce excessive mucus in response to a viral infection. Other symptoms of a cold may include sneezing, congestion, sore throat, and coughing.

Learn more about Rhinorrhea here:

https://brainly.com/question/34319474

#SPJ6

The circulatory system of organisms carries nutrients throughout that organism. Which cell structure has a similiar structure?

Answers

The answer is: Endomembrane system

What is the basic structural unit of both dna and rna?

Answers

The Nucleotide. DNA and RNA are both nucleus acids. Nucleic acids' monomer is called a nucleotide.

As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration

Answers

D. Cellular Respiration

The processes of endocytosis and exocytosis both require?

Answers

require cells to expend energy

Answer: Uses vesicles

Other Questions
2.Describe the similarities McWhorter draws between speaking and texting. Brianna built a rectangular flower garden. The garden is 10 feet long and 8 feet wide. What is the area of Briannas flower garden?. The "got milk?" campain targets everyone. this is an example of: The phoenician colonies never united because _______. Why do scientists study index fossils? Serra rode 15 mi in 1.5 hr. Phaelon rode 38 mi in 3.5 h. Justice rode 22 mi in 2.25 hr. Who had the fastest average speed? Suppose you have two credit cards. The first has a balance of $415 and a credit limit of $1,000. The second has a balance of $215 and a credit limit of $750. What is your overall credit utilization? Defined by distinct lines in the same place which never intersect each other and have the same slope A picture has a width that is 17 inches shorter than the length, and its total area is 480 square inches. Find the dimensions of the picture. Describe the official qualifications to register and vote in the state of texas. what changes would you suggest to the official qualifications and why? what is one-half of a globe called? How to algebraically find the inverse of a function? Which of the children described below is likely to experience the most difficulty in school? Why would a ship find sea beam technology beneficial A second number is 6 less than a first number. A third number is twice the first number. If the sum of three number is 306, find the numbers In science class, the girl to bot ratio is 3 to 7, if there are 50 students total in the class, how many are boys In the water cycle, which state of matter has the particles closest together? solid liquid gas plasma two hundred eighty-four thousand, one hundred eighty-seven in expanded form Which part of an egg is most similar to the cell membrane? Which graph represents the solution for the equation 1/6x=-2x+5 Steam Workshop Downloader