If rectangle ABCD is resized with a central point (−1, 1) and scale factor 3, what are the coordinates of D'?

A)(−3, 3)B)(−10, −5)C)(−5, −10)D)(−15, −15)

Answers

Answer 1
its B) (-10,-5). I had this test.

Related Questions

you can buy 5 cans of green beans at the Village Market for $2.20 you can buy at 10 of the same cans of beans at Sam's Club for $5.10 Which places is the better buy

Answers

the village market is the better place to buy green beans because there it is $0.44 ----- 2.20/5= .44
and at Sams they are $.51 ----- 5.10/10= .51
the village market as you pay 4.40 for 10 cans there

From beginning to end, explain the steps required to make a peanut butter and jelly sandwich.

Answers

First take the bread, jelly, peanut butter out and set on the counter, next get a plate and butter knife. Take two pieces of bread and set them on the plate. Next spread peanut butter on one piece of bread with the butter knife. Next spread jelly on the other piece of bread. Finally put the two pieces of bread together with peanut butter side and jelly side touching.

Answer:

take 2 peices of bread

apply jelly

apply penut butter

Put the two peices of bread together

Step-by-step explanation:

edmentem

Kimmy bought a 5kg mg can of peanuts for $4.50 what is the unit price

Answers

We know that the cost of 5 kg of peanuts is $4.50, then the unit price per kilogram is $4.50/5 kg = 0.90 $/kg And the unit price per gram is: $0.90 / kg * 1 kg/1000 = 0.0009 $/g or 0.09 cents/gram

The weight of a person on or above the surface of the earth varies inversely as the square of the distance the person is from the center of the earth. If a person weighs 180 pounds on the surface of the earth and the radius of the earth is 3900 miles, what will the person weigh if he or she is 325 miles above the earth's surface?

Answers

Weight = k/(distance)². Let's find the value of k when distance = earth radius:

180 = k/(3900)² → k = 180 x 3900² → k = 2,737,800,000

If he is at 325 miles ABOVE the earth, the distance becomes: 3,900+325=4,225 miles and his weight becomes:

Weight = k/(distance)² → Weight = 2,737,800,000/(4225)² = 153.37

Weight = 153.37 lb

Ray should consume 2,000 calories every day. He consumes 1,735 calories to get essential nutrients. What is Ray's discretionary calorie allowance? 115 calories 265 calories 1,735 calories 2,000 calories

Answers

2,000 - 1,735 = 265.

Answer: 265 calories

Step-by-step explanation:

The discretionary calorie allowance is the balance of a person can take after achieving the number of calories need to get essential nutrients.

Given : Every day Energy allowance for Ray =  2,000 calories

Energy level required to get essential nutrients =1,735 calories

Then Ray's discretionary calorie allowance =

Energy allowance - Calories required to get essential nutrients

=2000-1735=265 calories

Hence, Ray's discretionary calorie allowance will be 265 calories.

Tomas plans to work in his garden on a day when it is least likely to rain.

He checks the weather forecast for the following week

probability of rain

Monday 18%
Tuesday 12%
Wednesday 73%
Thursday 61%
Friday 20%

Tomas plans to work in his garden on Tuesday.

What is the probability that it will not rain on Tuesday?

Answers

your answer choice is going to be b, I hope that helps!

A cylinder and a cone each have a radius of 3 cm. and a height of 8 cm. What is the ratio of the volume of the cone to the volume of the cylinder?

Answers

Length x Width x Height = answer. So 3 x 8 = 24 so the volume is 24. 

12+22x=-46x I don't know the answer

Answers

The answer is

x =‌ −3/17

I'm guessing you're solving for x
12 + 22x = -46x
68x = -12
x = - 12/68
= -3/17

a 60 foot tree casts a shadow 85ft long. the sine of the angle between the ground and the line that connects the tip of the shadow to the top of the tree is approximately?

Answers

Final answer:

The sine of the angle between the ground and the line that connects the tip of the shadow to the top of the tree is approximately 0.7059.

Explanation:

To find the sine of the angle between the ground and the line that connects the tip of the shadow to the top of the tree, we can use the properties of similar triangles. Let's label the height of the tree as 'a' and the length of the shadow as 'b'. We have a right triangle with the height as the opposite side and the shadow as the adjacent side. The sine of the angle can be found using the formula sine(angle) = opposite/hypotenuse, which in this case is a/b. So, the sine of the angle is a/b = 60/85 = 0.7059 (rounded to four decimal places).

A farmer wants to fence a rectangular area by using the wall of a barn as one side of the rectangle and then enclosing the other three sides with 160 feet of fence. find the dimensions of the rectangle that give the maximum area inside.

Answers

Final answer:

To maximize the area with 160 feet of fencing and one side provided by a barn, the fencing should create a rectangle with equal width for the two sides perpendicular to the barn. By expressing length in terms of width and using calculus to find the maximum area, we find a width of 40 feet and a length of 80 feet maximizes the area.

Explanation:

The farmer is using the barn wall as one side of the rectangular area he wants to fence. The remaining three sides require 160 feet of fencing. To maximize the area of the rectangle with a given perimeter, the shape should be a square; however, since one side is already provided by the barn, the best we can achieve is to have the two sides perpendicular to the barn be equal in length.

Let's use width w to denote the length of the two sides that are perpendicular to the barn and length l to denote the side parallel to the barn but not including the barn's wall itself. The total amount of fencing the farmer has is 160 feet, which we can express using the equation:

2w + l = 160

Since we're optimizing for area A, and A = w x l, we want to find the values of w and l that give us the maximum A. We can express l in terms of w using the perimeter equation:

l = 160 - 2w

Substituting this into the area equation gives us:

A = w x (160 - 2w) = 160w - 2w²

To find the maximum area, we take the derivative of A with respect to w and set it to zero to find critical points.

dA/dw = 160 - 4w = 0

Solving for w gives us w = 40 feet. Therefore, the dimensions that give the maximum area when one side of a rectangle is fixed are a width of 40 feet and a length of 80 feet.

a rectangle is 9ft long and 40 in wide what is its area in square feet?

Answers

The answer is 360 sqft

If an investment of $3000 grows to $4432.37 in eight years with interest compounded annually , what is the interest rate?

Answers

[tex]\bf \qquad \textit{Compound Interest Earned Amount} \\\\ A=P\left(1+\frac{r}{n}\right)^{nt} \quad \begin{cases} A=\textit{accumulated amount}\to &\$4432.37\\ P=\textit{original amount deposited}\to &\$3000\\ r=rate\to r\%\to \frac{r}{100}\\ n= \begin{array}{llll} \textit{times it compounds per year}\\ \textit{annually, thus once} \end{array}\to &1\\ t=years\to &8 \end{cases}[/tex]

[tex]\bf 4432.37=3000\left(1+\frac{r}{1}\right)^{1\cdot 8}\implies \cfrac{4432.37}{3000}=(1+r)^8 \\\\\\ \sqrt[8]{\cfrac{4432.37}{3000}}=1+r\implies \sqrt[8]{\cfrac{4432.37}{3000}}-1=r \\\\\\ 0.0500001086\approx r\qquad\qquad\cfrac{r\%}{100}\approx 0.0500001086 \\\\\\ r\%\approx 100\cdot 0.0500001086\implies r=\stackrel{\%}{5}[/tex]

Evaluate (x + y)0 for x = -3 and y = 5.

A. -1/2
B. 0
C. 1
D. 2

Answers

0 * 2
0

Answer: B).

*All you have to do is add negative three plus five and make it 2, then multiply 2 times zero to get the answer.
Hello there! With the values of "x" and "y", they fill in the parenthesis. -3 + 5 is 2, because adding into a negative makes the number go up, or just simply subtracting 3 from 5 works as well. However, there is a 0 beside it, so we raise 2 to the 0 power. Anything that is raised to the 0 power is always equal to 1. And there is no other part of the question, so 1 is our answer. The answer is C: 1.

Karen works for $10 an hour. A total of 25% of her salary is deducted for taxes and insurance. She is trying to save $450 for a new set of tires. Write an equation to help determine how many hours she must work to take home $450 if she saves all of her earnings.

Answers

Ok, so they want an equation to help determine how many hour she must work to take home $450 dollars if she saves all of her earnings
We will let x represent the work hours

10x - (10x * .25) = 450

Now solve for x
10x - (10x * .25) = 450
10x - 10x * -.25 = 450
7.5x = 450
7.5x/7.5 = 450 / 7.5
x = 60 

So she will need to work 60 hours.

If you need help understanding how I derived at this conclusion, let me know.


simplify (9/4)^-3/2 x (125/27)^-2/3 x (3/5)^-2

Answers

The answer to this question would be 8/27 Hope I helped!

You are ordering a hamburger and can get up to 77 toppings, but each topping can only be used once. you tell the cashier to surprise you with the toppings you get. what is the probability that you get 00 toppings? express your answer as a fraction or a decimal number rounded to four decimal places.

Answers

There is a .0128 (1.28%) chance that you get 0 toppings out of 77. You have 1 through 77, giving you an option to get up to 77 toppings. Your 78th option is 0. So you have a 1 in 78 chance of getting 0 toppings.

8/10 divided by 1/3 Help Needed

Answers

8/10 / 1/3

flip the sign and the second number

8/10 (3/1)

multiply across

24/10

simplify

12/5

12/5 is your answer

hope this helps
Change sign and flip the second number
8/10*3/1= 24/10
Divide
24/10= 2.4 or 2 4/10= 2 2/5

A boat is traveling at a velocity represented by : 2x^3-10x^2+72x3−10x2+7. At the same time, current is pushing the boat in the same direction with a velocity given by : 5x^3+19x^2+4x5x3+19x2+4x. What is the total traveling velocity of the boat?

Answers

Answer:

7x^3 +9x^2 +4x +7

Step-by-step explanation:

The total velocity is represented by the sum of the two polynomials:

(2x^3-10x^2+7) + (5x^3+19x^2+4x) = x^3·(2+5) +x^2·(-10+19) +4x +7

... = 7x^3 +9x^2 +4x +7

what is 260% as a fraction in simplest form

Answers

2 and 3/5 is your answer.
2 3/5.The reason for this answer is that 260% also means 260/100 which equals to 2.6 or 2 3/5

14x^2-8x+3 + -6x^2+7x-11

Answers

your answer is 8x^2-x-8. hope this helps
8x^2-x-8 

:P yay I got the answer after about 10 minutes of work XD

Find the probability that your friend is at least 20 minutes late

Answers

If the graph has 1/3 length…

At least 20 minutes late: this would mean 20 minutes late or more.

20 or more minutes goes from 20 to 30. So that is a difference of 30 – 20 = 10. The distance of your rectangle is 10.

Length * width = (1/30) * 10 = 1/3 or 0.3333. The probability the friend is at least 20 minutes late is 0.3333.

Given the function h(x) = 4x, Section A is from x = 0 to x = 1 and Section B is from x = 2 to x = 3.

Part A: Find the average rate of change of each section. (4 points)

Part B: How many times greater is the average rate of change of Section B than Section A? Explain why one rate of change is greater than the other. (6 points)

Answers

Average rate of change in Section A:

[tex]\dfrac{h(1)-h(0)}{1-0}=\dfrac{4-0}{1-0}=4[/tex]

Average rate of change in Section B:

[tex]\dfrac{h(3)-h(2)}{3-2}=\dfrac{12-8}{3-2}=4[/tex]

As you can see, the average rates of change are the same, as expected. [tex]h(x)=4x[/tex] is linear, which means it has a constant rate of change over any interval in its domain.

Answer:

The rate of change of section A is 3 and rate of change of section B is 48.

Step-by-step explanation:

The given function is

[tex]h(x)=4^x[/tex]

Formula for average rate:

[tex]m=\frac{f(x_2)-f(x_1)}{x_2-x_1}[/tex]

Section A is from x = 0 to x = 1, the average rate of change of section A is

[tex]m_1=\frac{h(1)-h(0)}{1-0}=\frac{4-1}{1}=3[/tex]

Section B is from x = 2 to x = 3, the average rate of change of section B is

[tex]m_2=\frac{h(3)-h(2)}{3-2}=\frac{64-16}{1}=48[/tex]

Therefore rate of change of section A is 3 and rate of change of section B is 48.

[tex]m_1\times k=m_2[/tex]

[tex]3\times k=48[/tex]

[tex]k=12[/tex]

Therefore average rate of change of Section B is 12 times of Section A.

The given function is an exponential function and rate of change is not constant.

Gerard bought 9 hamburgers and 3 orders of fries for 24.75. Chris bought 6 hamburgers and 4 orders of fries for 19.50. Each hamburger cost the same amount. Each Order of fries cost the same amount. Wrote a system of equations that can be used to find how much one hamburger and one Order of fries cost.

Answers

9 hamburgers and 3 fries for 24.75 and 6 hamburgers and 4 fries for 19.50 can be represented by 9h + 3f = 24.75 and 6h + 4f = 19.5 Multiply by 4 36h + 12f = 99 and multiply by -3 -18h -12f = -58.5 12f and -12f cancel each other out 36h - 18h = 99 -58.5 18h = 40.5 h = 2.25 hamburgers cost 2.25 9h + 3f = 24.75 9(2.25) + 3f = 24.75 3f = 24.75 - 20.25 = 4.50 f = 150 fries cost 1.50 One hamburger and one fries can be represented by : h + f 2.25 + 150 = 3.75

What is the quotient? −4 1/2 ÷ (−2 2/3) Enter your answer as a mixed number, in simplified form, in the box. Will Mark Brainliest

Answers

The  quotient of −4 1/2 ÷ (−2 2/3) would be equal to  1 1/16 as a mixed number, in simplified form.

What are the Quotients?

Quotients are the number that is obtained by dividing one number by another number. We can use the fact that division can be taken as multiplication but with the denominator's multiplicative inverse.

Thus,

[tex]\dfrac{a}{\frac{b}{c}} = a \times \dfrac{1}{\frac{b}{c} } = a \times \dfrac{c}{b} = \dfrac{a \times c}{b}[/tex]

We have been given that [tex]-4 \dfrac{1}{2}[/tex]  ÷ (-[tex]2 \dfrac{2}{3}[/tex])

But first convert the mixed fraction into simple fraction

[tex]-4 \dfrac{1}{2}[/tex]  = -9/2

(-[tex]2 \dfrac{2}{3}[/tex]) = -8/3

Thus, we have to divide the terms;

[tex]-4 \dfrac{1}{2}[/tex]  ÷ (-[tex]2 \dfrac{2}{3}[/tex])

-9/2 ÷  -8/3

-9/2 x -3/8

27/ 16

In a mixed fraction; [tex]1\dfrac{1}{16}[/tex]

Hence, the quotient of −4 1/2 ÷ (−2 2/3) would be equal to  1 1/16 as a mixed number, in simplified form.

Learn more about the quotient;

https://brainly.com/question/26913992

#SPJ2

When Kaitlin divided a fraction by 1/2, the result was a mixed number. Was the original fraction less than or greater than 1/2? Explain your reasoning

Answers

If it was a mixed number is means the number is still greater than one, so to be divided in half and still be greater than 1 it had to be greater than 1/2 to begin with

Resolva o sistema a seguir:

2x - 4y = 8
x . y = 6

Answers

The answer is 16
2x-4y=8
2x-4(6)=8
2x-24=8
+24. +24
2x=32
X=16

Which best describes the formula for the perimeter of a rectangle? A. It’s twice the length plus the width. B. P = 2l + 2w is the perimeter of a shape. C. Double the length and width to get the perimeter. D. The formula for the perimeter of a rectangle is P = 2l + 2w.

Answers

... I think it is c I think it not right but I think it c...
In cases like this I'd strong suggest you look up the term involved.  Here, look up "Perimeter" or 'Permeter rectangle."

The firmula for the perimeter of a rectange of dimensions L and W is
P = 2L + 2W.

Find the area of the surface. the part of the paraboloid z=4-x^2-y^2 that lies above the xy-plane

Answers

Parameterize the surface (call it [tex]\mathcal S[/tex]) by

[tex]\mathbf s(u,v)=\langle u\cos v,u\sin v,4-u^2\rangle[/tex]

with [tex]0\le u\le2[/tex] and [tex]0\le v\le2\pi[/tex]. Then the surface element is

[tex]\mathrm dS=\|\mathbf s_u\times\mathbf s_v\|=u\sqrt{1+4u^2}\,\mathrm du\,\mathrm dv[/tex]

The area of [tex]\mathcal S[/tex] is then given by the surface integral

[tex]\displaystyle\iint_{\mathcal S}\mathrm dS=\int_{v=0}^{v=2\pi}\int_{u=0}^{u=2}u\sqrt{1+4u^2}\,\mathrm du\,\mathrm dv[/tex]
[tex]=\displaystyle2\pi\int_{u=0}^{u=2}u\sqrt{1+4u^2}\,\mathrm du=\dfrac{(17^{3/2}-1)\pi}6\approx36.1769[/tex]

You are building a rectangular garden and would like the area to be 32 square feet and the length twice the size as the width. What should the dimensions of your garden be?

Answers

check the picture below.

what's the length?  well, isn't it 2w?

The temperature in mariah’s town was at 5.2 f midnight. the temperature decreased at a steady rate of 1.1 per hour until 7:00 a.m. at 7:00 a.m. the temperature increased by a total of 4.9until noon. what was the temperature at noon?

Answers

it was 5.2 at midnight....the temp. decreased at a steady rate of 1.1 per hr until 7 a.m.....so it decreased 1.1 degrees every hr for 7 hrs....so it decreased by (1.1 * 7) = 7.7 degrees....so at 7 a.m. it is (5.2 - 7.7) = - 2.5......the temp increased by a total of 4.9 until noon.....so at noon it is going to be (-2.5 + 4.9) = 2.4 degrees F <==

The temperature at noon was 2.4 degrees Fahrenheit.

What are Arithmetic operations?

Arithmetic operations can also be specified by subtracting, dividing, and multiplying built-in functions.

To determine the temperature at noon, we need to first calculate the temperature decrease between midnight and 7:00 a.m. and then add the temperature increase from 7:00 a.m. to noon.

The temperature decreased at a rate of 1.1 degrees Fahrenheit per hour, and it took 7 hours from midnight to 7:00 a.m., so the temperature decreased by a total of 7 hours x 1.1 degrees per hour = 7.7 degrees.

The temperature at 7:00 a.m. would therefore be 5.2 degrees - 7.7 degrees = -2.5 degrees Fahrenheit.

At noon, the temperature increased by a total of 4.9 degrees, so the temperature at noon would be -2.5 degrees + 4.9 degrees = 2.4 degrees Fahrenheit.

Thus, the temperature at noon was 2.4 degrees Fahrenheit.

Learn more about Addition operations here:

brainly.com/question/25834626

#SPJ2

Other Questions
Why did the united states get involved in the korean war? what was the outcome of the war? By establishing this link between the levels of cooperation observed in _____ with local forest conditions, rustagi et al. have increased the confidence that scholars can have in the external validity of results from previous experiments carried out all over the world, with student and nonstudent subjects. Refer to landing service. because the company is known for its ability to produce lawn furniture more efficiently than any other company in the world, the company must have a(n) ____ advantage. If the mass of an object increases, the force acting on it, such as gravitational force, also increases. A manufacturer wants to implement a trade sales promotion. Which of the following would apply?A. Offering retail stores a 10% discount on their productsB. Offering mail-in rebates to consumers who purchase their productsC. Distributing coupons through newspapers for "buy one get one free" offers on their productsD. Purchasing television ads that promote the enhanced style of their products why did the catholic church feel threatened by the heliocentric theory of the universe A subway ride for a student costs $1.25. A monthly pass costs $35.Write an inequality that represents the number of times, x , you must ride the subway for the monthly pass to be a better deal. 10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Steam Workshop Downloader