Describe the components that should be included in a well-written scientific abstract and what should be excluded.
PLEASE HELP NEED ANSWER ASAP.

Answers

Answer 1

Answer:

The components of abstracts that should be included are as follows: " introduction, Description, limitations, conclusion". Other than these components anything else should be excluded.

Explanation:

The various components of an scientific abstract that should be included are as follows:

Introduction: In this part of the abstract it should contain the brief idea about the research.

Description: In the second part it should contain the research and the objective of the research and also about the analytical methodologies that has been applied in the research.

Critical: This is part in which the limitation for the research are present.

Language: The most important factor, the language used should be very formal type.

Conclusion: The things and ideas that had been learnt during the period of research. It should also contain the new findings and the trends that has came out during the research.


Related Questions

Florence Nightingale compared disease rates and other statistics for soldiers versus civilian populations. This is an example of __________.

Answers

Answer: Analytical epidemiology

Explanation: deals with the causes and effects of diseases, why they happened and how they occurred. In comparing the two populations, she sought to analyze the casual relationship between the two groups.

Neurons are the central building blocks of the nervous system. A neuron’s outer surface is made up of ______________ which allows smaller molecules and molecules without an electrical charge to pass through it, while stopping larger or highly charged molecules.

Answers

Answer:

semipermeable membrane

Explanation:

Neurons are the cells of the nervous system and have the plasma membrane as their outer covering. Their plasma membrane is also made up of two layers of phospholipids and the proteins are embedded in it. Therefore, the plasma membrane of neurons is a semipermeable membrane as charged and polar substances can not cross its nonpolar core made up of the hydrophobic tails of the phospholipids.

Similarly, the substances with a larger size can also not move freely across it. A semipermeable membrane allows only certain substances to move through it.

A student preparing for a hike wants to pack a snack that has biomolecules that provide quickly available Energy but few excess calories.Which nutrición label list the best combination of biomolecules the provide quickly available energy while providing the fewest calories form other types of moleculee

Answers

Answer:d

Explanation:

If the period of a wave decreases, its frequency must

A. decrease
B. halve
C. stay the same
D. increase

Answers

Answer:

D - increase

Explanation:

Answer: Its frequency increases

Explanation:

Period is the time taken for an object to complete a full cycle or revolution.

It is the inverse of frequency

i.e Period = 1/frequency

Thus, decrease in period is proportional to an INCREASE in frequency

A researcher is studying phases of the cell cycle in a population of cells during which there is an increase in the DNA content. This stage is most likely:

Answers

Answer:

Interphase

Explanation:

The cell cycle is the series of events that occurs in a cell leading to its division. It is characterized by two main phases viz: Interphase and the Mitotic (M) phase.

The Interphase also called the resting phase is the phase that occurs between two successive divisions of the cell. It is that time where the cell prepares, grows and duplicates its genetic material (DNA). The duplication or replication of DNA occurs specifically in the S-phase or Synthesis phase of the interphase, in which the molecules of DNA in the chromosomes doubles, hence, increasing its content.

It is pertinent that DNA doubles in the cell prior to division (mitosis) because each resulting daughter cell needs to contain an equal and correct amount of genetic material as the parent cell.

Therefore, according to the question, the cell will likely be at the Interphase stage of the cell cycle since Its genetic material has increased.

Alan is a 47-year-old man who has no documentation of a primary series of tetanus-containing vaccine. Which of the following would be an appropriate primary series for Alan?

Answers

Explanation:

For people 7 years of age and older who have not been previously immunized against tetanus, WHO recommends a 3-dose primary vaccination series with tetanus-diphtheria containing vaccine followed by 3 booster doses, to be protected throughout life.

Answer:

The appropriate primary vaccination series is as follows:

First dose - week oneSecond dose - 4 - 8 weeks after the first doseThird dose - 6 - 12 months after the second dose

Damage to which portion of the limbic system results in loss of memory of recent events and difficulty committing anything new to memory?
a. Cerebellum
b. Substantia nigra
c. Thalamus
d. Hippocampus
e. Hypothalamus

Answers

Answer:

The correct option is D. (Hippocampus)

Explanation:

Hippocampus is known as the part of the brain and situated in the bottom middle section inner folds which are called the temporal lobe. The main function of the hippocampus is memory and learning. It plays an important role in retrieve two types of memory which are known as declarative memories and spatial relationship memories.

1) Declarative memories: It is related to events and facts such as learning how to memorize lines.

2) Spatial relationship memories: It is related to routes and pathways such as when a driver learns pathways through the city.

Final answer:

Damage to the hippocampus in the limbic system causes the loss of recent memories and impairs the formation of new memories. It is critical for memory consolidation, unlike the substantia nigra, which is in the midbrain and related to movement.

Explanation:

The portion of the limbic system that when damaged results in the loss of memory of recent events and issues with forming new memories is the hippocampus. The hippocampus is vital for the consolidation of information from short-term memory to long-term memory and in spatial memory that enables navigation. Damage to this area, as in the famous case of patient H. M., who had his hippocampi removed, can lead to severe memory impairment, where the ability to form new declarative (explicit) memories is lost.

Regarding the structures of the forebrain, the substantia nigra is not part of the forebrain; it is located in the midbrain and is involved in reward and movement. When examining other parts of the brain such as the cerebellum, it is worth noting that this area is associated with motor learning and classical conditioning but is not involved with memory consolidation like the hippocampus.

Which perspective assumes that human behavior may have developed in certain directions because it served a useful function in preserving the species?

Answers

Answer:

656

Explanation:

Which structure in a stained cheek cell would most likely be visible when viewed through the high-power objective of a compound light microscope?

Answers

Answer:

The nucleus.

Explanation:

Because it gets stained

The structure in a stained cheek cell that would most likely be visible when viewed through the high-power objective of a compound light microscope is the nucleus, as the nucleus can be visible with certain types of the stain.

What is the importance of the nucleus?

One of the most important functions of the nucleus is to store and replicate the cell's genetic material, which ensures that the genetic information is passed on from one generation of cells to the next through DNA replication, it also plays a key role in the expression of genes, which is the process by which the instructions in the DNA are used to produce proteins and other molecules through transcription, translation, etc.

Hence, the structure in a stained cheek cell that would most likely be visible when viewed through the high-power objective of a compound light microscope is the nucleus, as the nucleus can be visible with certain types of the stain.

Learn more about the importance of the nucleus here.

https://brainly.com/question/17704494

#SPJ5

Sotonic saline and 5% dextrose in water are solutions that are considered Isotonic to human blood. What effect on red blood cells would you expect if a patient were given these fluids in an IV? A solution of 10% dextrose in water is hypertonic to blood. What would happen if you were to infuse your pationt with this solution?

Answers

Answer/Explanation:

1. Isotonic solutions are those with the same concentration of solute as another - in this case of human blood cells. The two solutions are said to have the same osmotic pressure, meaning they are in an equilibrium, and nothing will happen to the red blood cells.

2. In contrast, hypertonic solutions have more solute and less water than another solution, in this case the cytoplasm of the blood cells. I.e. the solution is more concentrated than the human blood cells. Therefore, water will flow out of the cell by osmosis to try to reach an equilibrium. This means that the red blood cell will shrink and shrivel up, as water leaves the cell in to the surrounding environment

Final answer:

Isotonic solutions like saline or 5% dextrose maintain the normal shape of RBCs by creating an osmotic equilibrium. Hypertonic solutions, like 10% dextrose, have a higher solute concentration than blood, causing water to leave RBCs, potentially leading to cell shrinkage and damage.

Explanation:

When a patient is given an isotonic saline solution or a 5% dextrose solution, it matches the solute concentration of human blood. As such, the red blood cells (RBCs) maintain their normal shape because water flows equally in and out of the cells, creating a state known as osmotic equilibrium.

However, a 10% dextrose solution is hypertonic, meaning it has a higher solute concentration compared to human blood. When a patient is given a hypertonic solution, water will leave the red blood cells to try to equalize the solute concentration. This can cause the cells to shrink or crenate, potentially leading to cell damage. Therefore, care must be taken when administering hypertonic solutions.

Learn more about Osmosis in RBCs here:

https://brainly.com/question/31835073

#SPJ3

What is the expected outcome if DNA from an ampicillin resistant organism is incorporated into an ampicillin sensitive organism by transformation and then the resulting organisms are allowed to reproduce on agar containing ampicillin?

Answers

Answer:

Only transformed cells will grow on agar containing ampicillin.

Explanation:

If the DNA from an ampicillin-resistant organism is incorporated into an ampicillin sensitive organism then the transformed ampicillin sensitive organism will get ampicillin resistant gene.

So when this transformed organism will allow growing on the agar containing ampicillin then this transformed organism will easily grow and reproduce on agar containing ampicillin because now it has an ampicillin-resistant gene which will protect it from ampicillin antibiotic. So the transformed cell will grow on agar containing ampicillin.

A PICC line is a short catheter inserted into the jugular vein. A PICC line is a catheter that allows for infusion of intravenous fluids without an infusion pump. A PICC line is a long catheter inserted through the veins of the antecubital fossa. A PICC line is a catheter that is used for emergent or trauma situations.

Answers

Answer:

A PICC line is a long catheter inserted through the veins of the antecubital fossa.

Explanation:

PICC (peripherally inserted central catheter) that are mainly used as a part of chemotherapy for the administration of the particular substances. This can be used for the long period of time in the individual.

The long catheter is inserted in the body through the skin mainly at the peripheral site of the body. This can be inserted for the weeks depending on the severity of treatment. The veins of the antecubital fossa is used for the insertion of the tube.

Thus, the correct answer is option (3).

Answer:

C

Explanation:

Many researchers think that the first eukaryotic cells obtained energy for life-sustaining functions from organic compounds. Given this information, which of the following organelles most likely appeared last in eukaryotic cells?
a.plasma membrane
b.chloroplast
c.ribosome
d.nucleus

Answers

Answer: Chloroplast

Explanation:

The presence of chloroplast would have been the last organelle which appeared in the eukaryotic cell. Chloroplast helps in photosynthesis which means prepare food from the inorganic compounds.

But here the cell obtains energy from the organic compounds which states that there is no need of chloroplast in the cell as they obtain energy by hetero tropic mode of nutrition.

Hence, chloroplast is the correct answer.

Assembling a complete sequence from fragment sequences
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?
Enter the complete DNA sequence, which should contain 24 bases.

Answers

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

A young student is trying to recapitulate an experiment discussed in the text. She introduces single-celled green algae into a petri dish containing predatory protists. After several generations, what will she observe?

A)The protists will produce multicellular colonies.
B)Green algae will form multicellular colonies.
C)Green algae will remain unicellular (i.e., there is no benefit to forming multicellular structures).
D)Both protists and green algae will remain unicellular.
E)None of the answer options is correct.

Answers

She will observe that Green algae will form multi-cellular colonies.

Explanation:

There are different advantages that can be obtained from the  characteristics of multicellularity of algae. The main thing that is very essential for the the nature of multicellularity is the coordination and cell interaction in algae. The cell communication can be achieved by the transfer of materials of cytoplasm.

The cellcommunication can also be achieved through the molecules that are diffusible in nature. these are are the unique and common characteristics of the organisams that are multicellular. They will be following a varied pattern of cell growth and cell division to form colonies.

The cerebellum and basal nuclei are involved in regulating motor activity, starting and stopping movements, and coordinating postural movements.

A. True
B. False

Answers

Answer:

The correct answer is - True.

Explanation:

The cerebellum is the major part of the brain that receives the sensory information and regulate the motor movements. The information that is come from the various parts of the brain helps motor neurons to coordinate different functions such as speech, balancing, maintaining posture.

It is the part of the base of the brain which is responsible for the various functions such as coordination and body movements. It is made up of the four bunch of nerve cells.

Thus, the correct answer is - true.

Final answer:

The cerebellum coordinates body movements and balance, whereas the basal nuclei regulate motor activity, initiation and termination of movements, and postural adjustments, making the statement true.

Explanation:

The statement regarding the cerebellum and basal nuclei (also known as basal ganglia) is True. The cerebellum is located just below the cerebrum and at the back of the brain, resting on top of the brainstem. It plays a crucial role in coordinating body movements, including balance, and is instrumental in motor tasks that are learned through repeated practice, such as playing a sport or typing. It achieves this by receiving and integrating sensory feedback from various parts of the body through numerous nerve pathways. On the other hand, the basal ganglia are a group of structures in the brain that help to regulate motor activity, including the initiation and termination of movements, as well as postural adjustments, alongside facilitating self-motivation.

Genetic variation _____. a. must be present in a population b. before natural selection can act upon the population c. arises in response to changes in the environment d. is created by the direct action of natural selection

Answers

Answer:

B.

Explanation:

This is the change in the amino acid sequence of DNA of an organism.

It is one of mechanisms of  Natural selection. Variation  makes some organism to develop selective advantages over others in the same population. Therefore they have resistance to selection pressure and more natural selected   above  others organisms in the same population

Final answer:

Genetic variation must be present in a population before natural selection can act upon the population.

Explanation:

Genetic variation must be present in a population before natural selection can act upon the population. It refers to the differences in the genetic material (DNA) among individuals within a population or species. The presence of genetic variation provides the raw material for natural selection to work on, as it allows certain traits to be favored or disadvantaged based on their fitness in a given environment.

Learn more about Genetic variation here:

https://brainly.com/question/32072667

#SPJ3

If the mouse was in a wire cage and only the weights of the mouse, food, and water were considered, would you come to the same answer as in Part A?

Answers

Answer:

Here is the full question:

(A) If a closed container contains a mouse as well as enough food, water, and oxygen for the mouse to live for 3 weeks,

How much will the container weigh 1 and 2 weeks later after the  mouse has eaten, drunk and exercised (respiration is CO2 emission), and why?

(B) If the mouse was in a wire cage and only the weights of the mouse, food, and water were considered, would you come to the same answer as in (A) and why?

Explanation:

(A) The mouse will weigh the same. This is because solids, liquid, and gases cannot escape the closed container. All of the life processes involving reactions conserve the atoms involved. Some of those atoms will appear in the form of gases, some as solids, and others as liquids but all will be retained in the closed container.

(B) In a wire cage, gases can escape. This means that the weight will not be the same after 1 and 2 weeks. The weight would be less than the original weight of the mouse, it's food, and it's water.

TOne possible conclusion that can be drawn about the activity of these two cells is that
(1) more active transport occurs in cell B than in cell A
(2) more active transport occurs in cell A than in cell B
(3) cell B uses some of the extra mitochondria to make food
(4) cell A is a plant cell since it has a cell wall Mitochondria Cell

Answers

Answer:

(2) more active transport occurs in cell A than in cell B

Explanation:

I suppose you meant the cells picture I attached.

(1) more active transport occurs in cell B than in cell A;

Active transport is the movement of molecules across a membrane from a region of lower concentration to a region of higher concentration. For this movement to occur, it requires cellular energy. From the diagram, cell B possess less mitochondria than cell A.

(2) more active transport occurs in cell A than in cell B;

From the above explanation, it is clear that cell A possess more mitochondria than cell B, active transport moves against a concentration gradient and therefore require energy which must be supplied by the cell. Due to this the cells capable of active transport usually have more mitochondria, in which respiration takes place than other cells.

(3) cell B uses some of the extra mitochondria to make food

From the diagram, it does not indicate the cell using any extra mitochondria to make food. Mitochondria produce energy by cellular respiration.

(4) cell A is a plant cell since it has a cell wall Mitochondria Cell

Animal cells do not have a cell wall but have a cell membrane. Plant cells have a cell wall composed of cellulose as well as a cell membrane; however, from the diagram, this information is invalid.

Karen falls down a flight of stairs and suffers spinal cord damage due to hyperextension of the cord during the fall. The injury results in edema of the spinal cord with resulting compression of the anterior horn cells of the spinal region. What signs would you expect to observe as a result of this injury?

Answers

Answer:

The spinal cord plays an important role in the organisms as all the nerves are extended from the spinal and the important component of the central nervous system.  The spinal cord plays an important role in the reflex action as well.

The spinal cord control the movement and functioning of the motor neurons. The injury in the spinal cord can cause the problem in sitting, standing or walking. The control of the skeletal muscles  of the lower limb of the body gets disturb during the spinal cord injury.

Final answer:

Following a fall resulting in spinal cord damage and compression of the anterior horn cells, Karen is likely to exhibit muscle weakness, loss of fine motor skills, and potentially paralysis in the muscles serviced by the affected spinal region. These symptoms stem from the impaired transmission of nerve impulses from the damaged cells to the muscles.

Explanation:

Karen's spinal cord damage due to hyperextension during a fall, resulting in edema and compression of the anterior horn cells, is a serious medical condition. The anterior horn cells, located in the gray matter of the spinal cord, are primarily responsible for initiating voluntary muscle contractions. When these cells are compromised, the most prominent signs one would expect to observe include muscle weakness, loss of fine motor skills, and in severe cases, paralysis of muscles in the affected regions. These symptoms occur because the damaged anterior horn cells cannot effectively transmit nerve impulses to the muscles, disrupting the neural circuitry that facilitates voluntary movement.

Moreover, the extent and severity of these symptoms largely depend on the specific segment of the spinal cord that is damaged. Since the spinal cord operates as the primary conduit for sending signals between the brain and the body, injuries to different segments can affect bodily control and sensation in various ways. Thus, immediate medical assessment and intervention are crucial to mitigate the impact of such injuries and enhance the chances of recovery.

A scientist collects a spore from a new species of fungus and observes that this spore has a flagellum. What does the presence of a flagellum suggest about the lifestyle of this species?

Answers

The question is incorrect as it does not have the options which are:

Its spores are produced asexually. It is an endomycorrhizal fungus. It is aquatic. It relies on insects for spore dispersal. It is unicellular.

Answer:

It is aquatic.

Explanation:

The spores are the asexual reproductive units produced by the algae and fungi which helps in the dispersal of the species.

When the spores possess the flagella, the spores are known as the zoospores which are produced in the zoosporangium.

The zoospores are the characteristic of the aquatic fungi like Synchytrium which are thin-walled and germinate to form a new mycelium.

Thus, the fungi are aquatic is the correct answer.

Answer:

The answer is B

Explanation:

Hope it helps  :)

Pedalfer soils would most likely be found _____. A. in the eastern half of the United States B. in the dry areas of the western United States C. in a tropical rain forest D. on an island close to the equator

Answers

Answer:

Pedalfer soils would most likely be found in the eastern half of United States

Explanation:

The climate in the eastern half of the US is humid and rainy. When leaves of trees fall off during an extreme rainfall event, leaves mix up with soil to produce padalfer soil. The word padalfer is based on the two elements is (aluminum and ferrous) that are commonly present in this soil type. These elements join the soil because of these biogeochemical cycles. This is also the reason that the word "padalfer", contains Al and Fe.

You decide to try your hand at canning pickles. You immerse freshly picked cucumbers in a solution that has a solute concentration twice that found in the cucumber cells. You allow your preparation to cure for several months in a sealed jar. When you later open the jar, you find that the fluid surrounding the pickles is more dilute than when you started.This change in concentration is due to_____.

Answers

Answer:

Exosmosis of water from cucumber cells into the fluid.

Explanation:

The solute concentration of the fluid in which cucumbers were immersed was higher than that of the cucumber cells. This means that the fluid was hypertonic with respect to the cucumber cells. This allowed movement of water from the hypotonic cucumber cells towards the hypertonic surrounding fluid. The process is called exosmosis with respect to cucumber cells. The loss of water from the cucumber cells by the process of osmosis diluted the surrounding fluid.

A gene is considered to be non-Mendelian in its inheritance pattern if it seems to "violate" Mendel's laws. Which of the following would then NOT be considered non-Mendelian?
A gene whose expression varies depending on the gender of the transmitting parent
A gene transmitted to males from the maternal line and from fathers to daughters
A gene transmitted via the cytoplasm or cytoplasmic structures
A gene derived solely from maternal inheritance
A gene transmitted by a virus to egg-producing cells

Answers

Answer:

A gene transmitted to males from the maternal line and from fathers to daughters.

Explanation:

Gregor Mendel through his research on pea plants, came up with three laws which are:

The Law of Segregation of genes: Each inherited trait is defined by a pair of  gene alleles. Genes are randomly separated to the sex cells so that sex cells contain only one allele of the pair.  The Law of Dominance: An organism with alternate forms of a gene will express the form that is dominant. The Law of Independent Assortment: Genes for different traits are sorted separately from one another so that the inheritance of one trait is not dependent on the inheritance of another.

In His work, he established the basic patterns of inheritance and it wasn't until after his death that sex linked inheritance patterns were identified.

He believed that a pair of genes called alleles, were transmitted, each allele from one parent and both alleles transmitted from each parent constituted the complete pair in the offspring.

However, if different variants of the same gene were inherited from both parents, the dominant gene is expressed in the offspring (phenotype).

Since the basis of his work established genes being equally transmitted by both parents to offspring, the variations being due to dominance, genes transmitted from mother to son and from father to daughter, follows the Mendelian pattern of inheritance.

The semilunar valves of the heart open at the onset of the ejection period. Approximately what percentage of the stroke volume is ejected during the first quarter of systole?

Answers

The percentage of the stroke volume is ejected during the first quarter of systole will be approximately 60% to 65%

Explanation:

The time interval between the atria contraction and the relaxation of ventricles are called as a Cardiac cycle. Systole denotes the heart contraction during the blood pumping. Diastole refers to the heart relaxation when the blood is filled in the heart chambers. The total blood is not fully pumped by the ventricles.

Instead they will pump only a proportion of blood in each of the cardiac cycle.  The ejection fraction refers to the proportion of the intraventricular volume that is received as a output in circulation process. A human with normal heart functioning can have approximately 60-65%. This is known to be stroke volume. The blood volume that is ejected is strove volume.

If you touch a hot stove, your spinal cord can prompt you to withdraw your hand without having to send the message all the way to the brain. This is due to what scientists call __________.

Answers

Answer:

The reflex arc

Explanation:

The reflex arc is a pathway in which sensory receptors sense the stimulus and the sensory neurons carry the sensory information to the spinal cord. Here, the spinal cord serves as the integrating center. It sends the motor information via motor neurons to the effector organs. This pathway followed by nerve impulses is called reflex arc in which the information is not sent to the brain for processing. This allows a quick generation of responses called reflexes. Touching a hot stove is sensed by the thermoreceptors of skin and the information follows the reflex arc to generate response.

Final answer:

The phenomenon described is a reflex arc, an automatic response to a specific stimulus that bypasses the brain to quickly prompt a reaction, like withdrawing a hand from a hot stove.

Explanation:

What you're referring to is what scientists call a reflex arc. A reflex arc is an automatic, involuntary response to a specific stimulus, such as pain from touching a hot surface. Unlike other types of nerve signals, the signals from a reflex arc don't need to go all the way to the brain to be processed. Instead, the signal goes to the spinal cord, which then sends a signal back to the muscles, prompting you to draw your hand away. This bypass of the brain helps speed up response time, which can be crucial in preventing injury.

Learn more about reflex arc here:

https://brainly.com/question/32286035

#SPJ12

While in South America, you come across what you think are two groups of birds in the same location. They are nearly identical aside from their color. After years of observation, you conclude that the birds eat similar diets and share similar behaviors but do not reproduce with each other. These groups of birds appear to be an example of:__________A) a single biological species.B) ring species.C) two different species on the basis of reproductive behavior.D) two different species on the basis of the ecological niche occupied.E) a single ecological species.

Answers

Answer: The answer is option C) two different species on the basis of reproductive behavior

Explanation:

This situation observed in South America is a good example of Sympatric speciation.

Where, two organisms similar in many respects by

- occurring in the same territory, differing ONLY as two different species because they DO NOT interbreed - thus, becoming different species on the basis of reproductive behavior.

So, option C is the answer

During which phase does the cleavage furrow start forming

Answers

Answer:

EARLY ANAPHASE

Explanation:

A cleavage furrow is a division which occurs in a cell's surface before cell division. It begins with cell's “pinching” its cell membrane and cytoplasm down the middle resulting in formation of two daughter cells.

Animal cell cleavage furrow is as a result of a ring of actin microfilaments known as the contractile ring, formed during EARLY ANAPHASE. The resultant bridge is divided and rearranged to yield two identical daughter cells when cytokinesis is occurring.

Gap junctions allow direct communication or ionic flow between adjacent cells for a(n) ________ synapse, while synapses that use neurotransmitters to signal from the presynaptic to postsynaptic cell are called ________.

Answers

Answer:

1. Electrical synapse

2. Chemical synapse

Explanation:

The nervous system is composed of the billions of neurons which communicate with each other through the generated nerve impulse. The transmission of the nerve impulse depends on the movement of ions which generate an electric impulse.

The impulse is passed from one neuron to another neuron through the neuronal gaps called synapses.

The neurons which transmit the signal in the form of the electrical signal through the gap junctions between the neurons which allow the direct transmission of the signal. The synapse in such neurons is known as an electrical synapse.

The neurons which transmit the signal by converting the electrical signal to chemical signal in the form of neurotransmitter contain the synapse called chemical signals.

Thus, Electrical synapse and Chemical synapse are correct.

Final answer:

Gap junctions enable direct electrical communication between cells in an electrical synapse, often found between certain interneurons and glial cells, whereas chemical synapses use neurotransmitters to facilitate intercellular communication.

Explanation:

Gap junctions allow direct communication or ionic flow between adjacent cells for a(n) electrical synapse, while synapses that use neurotransmitters to signal from the presynaptic to postsynaptic cell are called chemical synapses. Gap junctions are created by pairs of hemichannels, which are made up of connexin proteins.

These junctions permit the flow of cations, anions, and even small molecules such as ATP between cells, allowing for direct electrical signal propagation. Electrical synapses facilitated by these gap junctions are vital for certain interneurons in the brain and the retina as well as between glial cells like astrocytes. Whereas chemical synapses involve the release of neurotransmitters from the presynaptic cell which then bind to receptors on the postsynaptic cell, initiating a response.

You have learned that the envirronment affects how organisms vhange over generations. How would you explain a species that remains the same for millions?

Answers

Answer:

Selection might be the reason why a given organism does not change over generations

Explanation:

This statement might be a very rare case in nature to be observed. There are some particular scenarios that can provide such cases. Imagine you are on an island that the environment conditions are not too much variable. In such conditions, the organisms that live on that island does not suffer a high amount of selective pressure from the environment. Although changes might naturally occur because of mutations on the genome, the stable conditions of the environment do not exert changes on the living organisms, and most importantly, the eventually changes that mutations provide, will be cancelled by the same stable environment conditions. So, the given species might remain the same for millions of years.

Other Questions
Coordinate of 2x+6y=12 and 4x-3y=9 Whiteside Corporation issues $500,000 of 9% bonds, due in 10 years, with interest payable semiannually. At the time of issue, the market rate for such bonds is 10%. These points are linear.Find the slope.x|2|3|4 5 6 7y 10/15/20 25 30 35slope = [?] Which equation demonstrates the distributive property?A)36 + 9 = 45B)36 + 9 = 3(12 + 3)C)36 x 9 = 9 x 36D)(12 + 3)3 = 3(12 + 3) Top managers are responsible for the ultimate responsibilities within an organization,which include which of the following? (Choose all that apply.) 1.How departments should interact 2.Cross-departmental responsibility 3.Middle managers and their employees 4.Establishment of organizational goals? Which statement best describes Europe just before World War I? a The formation of opposing alliance systems increased international distrust. b European leaders resorted to a policy of appeasement to solve international disputes. c The communist nations promoted violent revolution throughout Western Europe. d Most nations practiced isolationism and just worried about their own countries issues. When the government imposes a corrective tax, the market produces a socially optimal quantity, but there is a welfare loss becauseI. there is a decrease in consumer surplusII. there is a decrease in producer surplusIII. the tax decreases employees' incentives to work People's views of themselves, others, organizations, and nature are part of which macroenvironmental force? During December, Moulding Corporation incurred $87,000 of actual Manufacturing Overhead costs. During the same period, the Manufacturing Overhead applied to Work in Process was $85,000. Required: Prepare journal entries to record the incurrence of manufacturing overhead and the application of manufacturing overhead to Work in Process. (If no entry is required for a transaction/event, select "No journal entry required" in the first account field.) Learning Goal: To practice Problem-Solving Strategy 7.1 Rotational dynamics problems. Suppose that you are holding a pencil balanced on its point. If you release the pencil and it begins to fall, what will be the angular acceleration when it has an angle of 10.0 degrees from the vertical? Is each product less than 1 equal to 1 or greater than 1 ? 2 x 1/3 5 x 1/3 1/2 x 3 What was Rome's influence on government and democracy?Rome adopted the idea that individuals were citizens not subjects.Rome left its written legal code and the idea of equal and impartial justice.Rome gave the world the idea of a republic. Two force vectors are perpendicular, that is, the angle between their directions is ninety degrees. If their magnitudes are 4.52 newtons and 7.33 newtons, then what is the magnitude of their sum?F=__________ newtons NEED HELPP ASAP!!!!This is when opposite poles of a magnet move toward each other and toward certain types of materials. The second-order rate constant for the following gas-phase reaction is 0.041 1/MLaTeX: \cdots. We start with 0.438 mol C2F4 in a 2.42 liter container, with no C4F8 initially present. C2F4 LaTeX: \longrightarrow 1/2 C4F8 What is the half-life (in seconds) of the reaction for the initial C2F4 concentration? Enter to 1 decimal place. Short-term tactical plans are defined by:_______.A. Defined by CustomerB. Set before objectives can be determinedC. Supportive of strategic objectivesD. Normally opposite of long range objectives. A chef sees unused ingredients in the refrigerator so wants to design adapt a recipe to a recipe he can make with the ingredients he has. What steps will he take to determine the number of portions he can make if he cannot make a full recipe? Nosotros nos ________ las chaquetas, pero las olvidamos en el carro. pondramos pondran pondamos ponan Many companies use more than one marketing channel to distribute their products to the same target market, a tactic called a. multiple channeling. b. strategic channel alliance. c. intensive distribution. d. market splitting. a. multi channel distribution. (30 Points, please explain your answer) Data were collected and showed an increase in ice cream sales as the weather gets warmer.Which of the following best describes this situation? Based on the data, this is an example of correlation. Based on the data, this is an example of causation. Based on the data, this is not an example of causation or correlation. Steam Workshop Downloader