Over long periods of time, rock materials erode down the side of a mountain. What type of rock would you must likely find at the bottom of the mountain

Answers

Answer 1
u would mostly find a sedimentary rock

Related Questions

An organ, in any multicellular organism, would BEST be described as

Answers

A group of tissue that work together to preform a specific function.

The right answer is D) a structure made of two or more tissues functioning together for a common purpose.

An organ is a set of specific tissues capable of performing one or more specific functions. The human body has 78 organs and these organs can be grouped into systems (there are 11 of them) to perform more complex functions. For example, the bronchi and lungs are organs that belong to the respiratory system. Organs are necessary to live in good health and some organs are essential. These are the brain, heart, lungs, kidneys, liver and pancreas.

Where is the chloroplast located?

Answers

What is called Plant Cell!

Answer:

in the plant cell

Explanation:

Chloroplast, structure within the cells of plants and green algae that is the site of photosynthesis, the process by which light energy is converted to chemical energy, resulting in the production of oxygen and energy-rich organic compounds. Photosynthetic cyanobacteria are free-living close relatives of chloroplasts; endosymbiotic theory posits that chloroplasts and mitochondria (energy-producing organelles in eukaryotic cells) are descended from such organisms.

Rough Er is connected to the _______ membrane

Answers

The rough er is connected to the plasma membrane
The plasma (cell) membrane. 



Humans have _____.
an exoskeleton
jointed appendages
segmentation
no coelom

Answers

It is jointed appendages

Answer: The correct answer for the blank is-  Jointed appendages.

Appendage can be described as a part of the body that usually depicts an outgrowth in the body of an organism. Example- Legs, arms, fingers

Human beings have jointed appendages. These appendages possess bones that are linked to each other with the help of skeletal muscles, which are attached to cord like tendons that in turn are linked with bones of the appendages.

Therefore, jointed appendages is the right answer.


Auxins _____.
A) promote cell elongation and cell division in stems
B) stimulates seed growth and fruit development
C) promotes cell division
D) regulates the opening and closing of stomata

Answers

A) promote cell elongation and cell division in stems.

Final answer:

Auxins are plant hormones that promote cell elongation and, in conjunction with cytokinins, can also stimulate cell division, primarily in stems. They play crucial roles in plant growth processes, such as phototropism, gravitropism, and leaf development. The correct answer to the question 'Auxins _____.' is (A) promote cell elongation and cell division in stems.

Explanation:

Auxins are a group of plant hormones that play critical roles in various aspects of plant growth and development. One of the key functions of auxins is to promote cell elongation and division, particularly in stems. Auxins work in conjunction with other hormones like cytokinins to regulate plant growth, where cytokinins themselves promote cell division and growth. While auxin is responsible for stimulating cell elongation, cytokinins alongside auxins can induce cell division.

Additionally, auxins are involved in processes such as phototropism—where plants bend towards light—gravitropism, differentiation of vascular tissue, and leaf development and arrangement. Auxin concentration levels, which are higher in the stem, affect cell differentiation and fate. Thus, when discussing the options given, auxins specifically promote cell elongation and cell division in stems (option A), and are also known to have roles in promoting rooting, flowering, fruit setting and ripening, and the organization of xylem and phloem.


what would happen if the protein coat of a virus that infects a bacterium is labeled with radioactive sulfur and DNA of the virus is labeled with radioactive phosphorus? ...?

Answers

Only the phosphorus will be found inside the bacterium when the protein coat of a virus that infects a bacterium is labeled with radioactive sulfur and DNA of the virus is labeled with radioactive phosphorus.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!

What do the two arrows in the diagram most likely represent?
A. radiation
B. photosynthesis
C. cellular respiration
D. energy conversions

Answers

If you are referring to the diagram with the sun, the trees (producers) and the deer (consumers), then the correct answer is D. energy conversions

The diagram shows how energy is converted from one form to another, going from the source, to the producer, to the consumer.

The right answer is energy conversion.

In the image we observe a plant producing energy in the form of carbohydrates thanks to photosynthesis, then the caterpillar will eat it and recover its energy (which its carbohydrates). then this insect will be eaten by the frog and will recover its energy in the form of carbohydrates (and also proteins), the same thing with the snake and the bird.

From sea level,the biosphare goes up about 9 km and down about 19 km. Whats is the thickness of the biosphere in meters?

Answers

The solution to the problem is as follows:


  9,000 + 19,000 = 28,000 meters


Therefore, the thickness of the biosphere would be 28,000 meters.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!

Which organisms is most closely related to a human? Why?
Cat, whale, bat, lizard, bird, or frog

Answers

The cat. Although the cat has fewer carpal bones, their Ulna is connected on the opposite side, and their Radius and Ulna are a bit closer together the cat's ligaments shape and "finger" length are similar.
A dolphin’s flipper, bird’s wing, cat’s leg, and the human arm are considered homologous structures. Whereas human beings have bones such as the humerus, ulna, radius, wrist bones, and fingers, these features appear as similar bones in form in the other animals. Bats, whales, and many other animals have very similar homologous structures, demonstrating that these creatures all had a common ancestor.The tailbone in human beings is so-named because it is a homologous structure to the beginning of many animals’ tails, such as monkeys. It is known as "vestigial" because it is the last vestige of what was once a tail.All mollusks have a "foot" that they use to travel. This foot is homologous although it may not appear to be immediately – close inspection demonstrates that in terms of form and function, gastropods, cephalopods, and bivalves share this homologous structure in common.Mammals share the homologous structure of the vertebrae in common. For instance, in spite of its height, the giraffe has the very same number of neck bones (seven) as a giant whale and a tiny human being.Human beings, dogs, and cats all have similar pelvises, which are homologous structures to a vestigial pair of bones that snakes have. These bones are the last remains of a pelvis, with no legs to attach. Our eyes are homologous to the eye bulbs which blind creatures who live in caves have on their heads.All organisms contain homologous plasma membranes with what is called a phospholipid bi-layer.The wrist bone of the human being is homologous with the structures of many other animals, including the dolphin and the bird. A homologous structure in the panda looks like a sixth appendage, but it is actually a modified wrist bone that helps the panda bears pick leaves off the trees more dexterously.An auditory bone that exists inside the ear of mammals is a homologous structure to the reptile’s jaw bone (including the dinosaurs) as well as the jawbone of species of fish that are still in existence today.The carpals, metacarpals, and phalanges of the human hand have homologous structures in a variety of animals, and they’re not all mammals.  For instance, these features are seen in penguins and reptiles as well as the mammals to which human beings are more closely related.The genetic code among all living things is homologous – extremely similar although other genetic codes exist.  This suggests a common ancestor.Wasps and bees have stingers that they can use when they feel they are in danger.  However, this is a homologous structure to the ovipositor of other organisms – the feature that allows these organisms to lay eggs.

The one-toed horse of today steadily evolved from its five-toed ancestor. Which theory of evolution can explain this example?
A: adaptive radiation
B: punctuated equilibruim
C: gradulism

Answers

The answer is C: gradulism.

Gradualism describes the rates of speciation. It means that evolutionary changes in species are slow, gradual and continuous process. In our example, The one-toed horse of today steadily evolved from its five-toed ancestor. Steadily is the key word. So, the change was slow and continuous process.

If the change were rapid, this would be an example of punctuated equilibrium.

What is the molecular formula of methyl butanoate.what is the empirical formula of methyl butanoate.?

Answers

Molecular Formula = C₅H₁₀O₂
Empirical Formula = C₂.₅ₓH₅ₓOₓ

Hope this helps!
Final answer:

The molecular and empirical formulas of methyl butanoate are both C5H10O2, representing the exact composition and simplest ratio of its atoms, respectively.

Explanation:

The question you've asked is about the molecular and empirical formulas of methyl butanoate. First, let's clarify that the molecular formula tells us the exact number of atoms of each element present in a compound, while the empirical formula gives the simplest whole-number ratio of these atoms.

The molecular formula of methyl butanoate is C5H10O2, indicating that each molecule consists of 5 carbon atoms, 10 hydrogen atoms, and 2 oxygen atoms. However, the information provided mistakenly pairs the empirical formula and molecular formula of another compound, indicating an error. In practice, methyl butanoate itself, given its molecular formula, would technically have the same empirical formula as the molecular one (C5H10O2) since its ratio of atoms cannot be simplified further.

Non-coastal cities face what kind of danger from hurricanes?
a. storm surge
b. lightening
c. high winds
d. flooding

Answers

d.
hope i helped out!

Which of the following statements is true?
a)Cloning creates genetically identical offspring.
b)Recombinant DNA injects genes from bacteria into an organism.
c)Dog and horse breeds are the result of years of recombinant DNA breeding.
d)Selective breeding can be used to create pesticides and cancer drugs.

Answers

I think that the Answer might be (a

Answer:

A. Cloning creates genetically identical offspring.

Explanation:

graded correct.

The prior unit curriculum was worded in a way a to make the word "offspring" within this question ambiguous. (adjective .  open to more than one interpretation; having a double meaning.   or unclear or inexact because a choice between alternatives has not been made.)

Which is why most students are here, because curriculum & question wording are often tricky.

provides a mechanism by which the chromosome number may be kept the same from one generation to another

Answers

The process that keeps the number of chromosomes or chromosome number the same from one generation to the next is mitosis.

Veins are often formed from hot water solutions. true or false?

Answers

Answer:

I belive the answer to your question is True

Explanation:

True, veins are formed from hot water solutions that become supersaturated with minerals, which then crystallize and deposit in cracks within rocks.

When underground water is heated by magma, it can dissolve more particles than cold water. This hot, salty solution then chemically reacts with surrounding rocks, picking up more dissolved particles.

As this water moves through open spaces in rocks, it deposits solid minerals. When these minerals fill cracks in rocks, they create deposits known as "veins".

In contrast, when minerals are deposited in open spaces where there's room for growth, large crystals can form, resulting in structures known as geodes.

An ATP molecule is made up of which of the following?
A) Phosphate groups, ribose sugar, adenine base
B) Phosphate groups, deoxyribose sugar, thymine base
C) Carboxylic group, ribose sugar, adenine base

Answers

A) Phosphate groups, ribose sugar, adenine base

A computer program that lets you investigate an image in 3-D is an example of what type of model?

A.conceptual

B.statistical

C.visualization

D.numerical

Answers

The correct answer is C) Visualization. Hope this helps.

Answer:

C.visualization is the correct answer.

Explanation:

A computer program that lets you investigate an image in 3-D is an example of visualization model.

visualization model is the process of creating animations, images, and diagrams.

Visualization model explained as a technology that produces a visual dimension.

The visualization enables an object to been viewed with the help of computer modeling.

The sex of mammals is determined by:
a. the autosomes they receive.
b. the type of sex chromosomes received.
c. the number of recessive chromosomes received.
d. none

Answers

b. the type of sex chromosomes received.

Hope this helps!

how will you classify the volcanoes that have records of eruption

Answers

Answer:

Volcanoes that have records of eruption are classified as active.

Explanation:

Currently there is no way accepted worldwide by all volcanologists to define an "active" volcano, since the life of a volcano can range from months to millions of years.

For this reason a volcano could be considered active only in comparison to human life expectancy. Thus, scientists consider active volcanoes those who have unusual seismic activity or have new gas emissions that must be considered, that is, they are about to explode.

Taking this definition into account, any volcano that has had an eruption in the course of human life is defined as active.

18.
The most prominent features of a narrow, V-shaped valley, where the stream profile drops rapidly, are _____.

meanders and floodplains
rapids and waterfalls
lakes and ponds
deltas and natural levees 18.
The most prominent features of a narrow, V-shaped valley, where the stream profile drops rapidly, are _____.

meanders and floodplains
rapids and waterfalls
lakes and ponds
deltas and natural levees

Answers

The correct answer is rapids and waterfalls.  

Rapids refers to the segments of streams with extensively vigorous currents, various obstacles, and steps in their streambeds. A waterfall refers to a vertical drop in a stream bed. Both are the locations of vigorous erosion.  

The rapids are generally produced where the resilient bedrock limits a stream to a narrow channel and forces an enhancement in the velocity of water.  

On the other hand, waterfalls are produced where the fast-flowing water negotiates a geologic contact amid the more resilient and less resistant layers of rock, or through a fault, which has analogized distinct kinds of rocks. Or it can be said that waterfalls usually produce at the end of a series of rapids.  


Describe the experiment you would use to test the hypothesis. Be sure to include variables as well as experimental and control groups

Answers

Final answer:

An experiment to test a hypothesis would typically involve an experimental group and a control group. The independent variable, such as the use of technology, would be manipulated in the experimental group but not in the control group. By comparing the results of the two groups, the impact of the independent variable can be determined.

Explanation:

An experiment designed to test a hypothesis would typically involve two groups: the experimental group and the control group. The experimental group would receive the experimental manipulation or treatment, while the control group would not. By comparing the results between the two groups, any differences can be attributed to the experimental manipulation.

For example, let's say the hypothesis is that using technology enhances learning. The experimental group would use technology during a learning activity, while the control group would not use technology. The dependent variable, in this case, would be the learning outcomes, while the independent variable would be the use of technology.

The experiment would involve measuring the learning outcomes of both groups and comparing the results to determine if there is a significant difference. By controlling other factors that could influence the results, such as the teaching method or the participants' prior knowledge, the experiment can provide evidence to support or refute the hypothesis.

In some bees, thin stripes (S) are dominant over thick stripes (s) and black eyes (B) are dominant over gray eyes (b). Complete a dihybrid cross for parents with the genotypes: SsBB × ssBb and answer the following in complete sentences.

Describe how you would set up a Punnett square for this cross.
List the likelihood of each possible offspring genotype.
List the likelihood of each possible offspring phenotype.

Answers

I think you would do a 2X2 punnet square. And that the SsBB can produce two kinds of gametes which are SB and sb And that the ssBb can produce two kinds of gametes which are sB and sb So there would be 25% SsBB, 25% SsBb, 25% ssBb, and 25% ssbb

Answer:

Genotypic Ration -

SsBB: ssBB: SsBb:ssBb  is 4: 4:4:4

Likelihood of occurrence is  

SsBB: 25 %

ssBB: 25 %

SsBb:25 %

ssBb:25 %

Phenotypic ratio -

thin striped black eye :  thick striped black eye

8 : 8

1: 1

Likelihood of occurrence is  

thin striped black eye :  50%

thick striped black eye : 50%

Explanation:

The genotype of  two parents is SsBB and ssBb

The alleles for cross for parent with genotype SsBB are  SB, SB, sB, SB

The alleles for cross for parent with genotype ssBb are sB, sb, sB, sb

The cross between the two parents is represented by a punnet square as given below -

        SB          SB          sB         sB

sB SsBB SsBB ssBB ssBB

sb SsBb SsBb ssBb ssBb

sB SsBB SsBB ssBB ssBB

sb SsBb SsBb ssBb ssBb

Genotypic ratio

SsBB: ssBB: SsBb:ssBb  is 4: 4:4:4

Likelihood of occurrence is  

SsBB: 25 %

ssBB: 25 %

SsBb:25 %

ssBb:25 %

As given thin stripes (S) are dominant over thick stripes (s) and black eyes (B) are dominant over gray eyes (b).

So the phenotype for genotype of offsping is as follows

SsBB: thin striped black eye

ssBB: thick striped black eye

SsBb: thin striped black eye

ssBb: thick striped black eye

Phenotypic ratio -

thin striped black eye :  thick striped black eye

8 : 8

1: 1

Likelihood of occurrence is  

thin striped black eye :  50%

thick striped black eye : 50%


Will notices that crickets seem to chirp more frequently at night in June than they do in October. He asks himself, "How do temperature changes affect how often crickets chirp"? If he were to perform an experiment, which of these statements would be the best hypothesis?
A)
Crickets are inactive in October.
B)
Do crickets like warm weather better than cold weather?
C)
Crickets chirp more frequently as temperature increases.
D)
Crickets chirp for many reasons, and temperature is probably one reason.

Answers

The correct answer among the choices provided by your question is the third choice or letter C. The statement "Crickets chirp more frequently as temperature increases." would be Will's best hypothesis on his experiment.I hope my answer has come to your help. Thank you for posting your question here in Brainly.

Answer: Option (C) is the correct answer.

Explanation:

In June, it is known that temperature is more hotter than as compared to temperature in October.

Therefore, due to the increase in temperature crickets move out of their initial place and hence they chirp. Whereas in October temperature is less so, crickets prefer to stay at their initial place and doesn't chirp.

Thus, we can conclude that the statement crickets chirp more frequently as temperature increases would be the best hypothesis.

Jason is trying to explain to his friend how the body stores energy. Which analogy would best suit Jason's explanation?
Answer
The body storing energy is like a car holding gas: the car's gas tank keeps the gas until it is needed.
The body storing energy is like a group of shoppers in a store: individuals may come and go but the numbers stay about the same.
The body storing energy is like people working to earn money: when they get paid they spend it all.
The body storing energy is like a toy needing batteries: when the batteries run out, they are thrown away.

Answers

The best and most correct answer among the choices provided by your question is the first choice.

The best analogy would be: the body storing energy is like a car holding gas: the car's gas tank keeps the gas until it is needed.

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!

The correct analogy is the body is storing energy like a car holding gas, the car's gas tank keeps the gas until it is needed.

Provided the case, if a person is healthy, then his or her body possesses the tendency of obtaining the energy from each and anything he or she eats. That is why if one consumes more energy than required by the body, then the person gains weight as the body accumulates or stores the excess energy in the form of fat.  


What is the smallest packet of electromagnetic energy that can be absorbed or emitted?

a proton
an electron
a quantum
a wave

Answers

A Quantum is the smallest packet of electromagnetic energy that can be absorbed or emitted

so, option C is your answer!

Hope this helps!

The correct answer is quantum.

Quantum is the smallest is the smallest quantity of energy that can be emitted or absorbed .This can be absorbed or emitted in the form of electromagnetic radiation. The energy of single quantum can be given by the equation:

E=hν where E= energy absorbed or emitted

h=plank's constant 6.63 x 10⁻³⁴ Js,

ν= frequency of radiation.






Does DNA replication take place in the same direction along both strands of the DNA molecule that is being replicated? ...?

Answers

No, replication proceeds in opposite directions between replication forks.
I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
Final answer:

During DNA replication, the leading strand is synthesized continuously towards the replication fork, while the lagging strand is replicated in a discontinuous manner away from the replication fork direction, in segments called Okazaki fragments.

Explanation:

No, DNA replication does not take place in the same direction along the two DNA strands. Both strands of the parent DNA molecule serve as templates for replication, however, they are replicated in different directions due to their anti-parallel structure. The new DNA strands that form are complementary to parent strands.

One strand, known as the leading strand, is replicated continuously in the direction of the replication fork. The DNA polymerase enzyme extends it from the 5' end to the 3' direction. This direction is maintained due to the orientation of the parent DNA strand, which is in the 3' to 5' direction.

The other strand, termed as the lagging strand, is synthesized in a discontinuous manner, away from the replication fork direction, in Okazaki fragments. These fragments are replicated individually with each requiring a primer for synthesis to begin. This happens because the parent strand to which the lagging strand is complementary, has a 5' to 3' direction, the opposite of the replication fork's direction.

Learn more about DNA Replication here:

https://brainly.com/question/34852279

#SPJ11

What is the best source of nuclear DNA when working with hair samples?

Answers

Nuclear DNA is the one found in the nuclei of eukaryotic organisms, which is why the best part would be to analyze the Root of the hair because it would be the freshest and the most pure sample for analysis.

Answer: The correct answr is- Root of hair or hair follicle.

Nuclear DNA is present in the nucleus of eukaryotic cells. When working with the DNA samples, the best source of nuclear DNA is hair root that anchors the whole shaft of hair. Hair root possesses cells that are called as keratinocytes. These cells are ideal for the extraction of nuclear DNA.

Thus, root of hair is the right answer.

Which famous scientist is credited as the founder of the scientific method?
Aristotle
John Dalton
Sir Francis Bacon
Sir Isaac Newton

Answers

I have heard that Francis Bacon invented the scientific method, but I have also heard that it began with Aristotle.

Answer:

Sir Francis Bacon

Explanation:

He was the first to formalize a the concept of a true scientific method. However, the work of other scientists such as Nicholas Copernicus also influenced his thinking. But Francis Bacon is mostly credited as the founder of the scientific method.

Which of the following measurements is the most accurate for a pellet with a mass of 3.25 grams? a. 3 grams b. 3.20 grams c. 3.27 grams d. 3.50 grams

Answers

 Correct answer is,
3.27 grams

Answer: 3.27 grams

Explanation:

The value that is measured should have minimum error and minimum difference in weight with respect to the actual weight of the equipment.

The original weight of the pellet with a mass of 3.25 grams is measured and the most accurate weight around this number is 3.27.

The slight difference is due to error and this error can be calibrated.

Hence, the correct option is 3.27.

Can you relate the structure of the chloroplast to the phases of photosynthesis

Answers

Final answer:

Photosynthesis occurs in two key stages: the light-dependent reactions that take place inside the thylakoid membrane and the Calvin Cycle, or the light-independent reactions, that occur within the stroma of the chloroplast. These structures within the chloroplast facilitate the energy capture, conversion, and the eventual build-up of sugar molecules. It's through the structural details of the chloroplast that photosynthesis is made possible.

Explanation:

Photosynthesis takes place in two key stages: the light-dependent reactions and the Calvin cycle, or the light-independent reactions. Both of these stages are linked to the physical structure of the chloroplast.

The chloroplast has an outer membrane, an inner membrane, and inner structures like the thylakoids and stroma. The thylakoids, which are stacked into structures called grana, are responsible for the light-dependent reactions. Energy from the sunlight is captured by chlorophyll molecules and converted into a chemically stored form. This takes place within the thylakoid membranes.

On the other hand, the fluid-filled region inside the chloroplast, called the stroma, facilitates the Calvin cycle. The energy derived from the light-dependent reactions is used in the stroma to assemble sugar molecules from carbon dioxide.

Energy transfer between these two stages is facilitated by energy-carrying molecules that move between the site of light-dependent reactions (thylakoids) and the location of the Calvin cycle (stroma).

Learn more about Photosynthesis and Chloroplast Structure here:

https://brainly.com/question/31236664

#SPJ3

The structure of the chloroplast, including the double membrane, stroma, and thylakoids, is closely related to its function in photosynthesis, which occurs in two stages: light reactions and the Calvin cycle. The arrangement of thylakoids maximizes light absorption and energy transfer, enhancing the efficiency of photosynthesis.

The structure of a chloroplast is intricately tied to its function in photosynthesis, which occurs in two main stages: the light reactions and the Calvin cycle.

Chloroplasts have a double membrane with an inner space called the stroma. Within the stroma are stacks of thylakoids, which are disc-shaped membranes that house chlorophyll and other pigments. These stacks are called grana.

Light Reactions

The light reactions occur in the thylakoid membranes. Here, chlorophyll absorbs sunlight and converts it into chemical energy in the form of ATP and NADPH.

The Calvin Cycle

In the stroma, the Calvin cycle uses ATP and NADPH from the light reactions to convert carbon dioxide into glucose.

Efficiency of Photosynthesis

The arrangement of thylakoids in stacks maximizes the surface area for light absorption, and their membrane structure facilitates the efficient transfer of energy through electron carriers. This optimized arrangement ensures that the light-dependent reactions produce the maximum amount of energy needed for the Calvin cycle.

Thus, the structure of the chloroplast directly enhances its function in photosynthesis, making the process highly efficient.

Other Questions
Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period Algae uses all the energy in sunlight to perform photosynthesis.true or false what is 2 1/2 divided by 1/3 The ratio of the number of red marbles to the number of green marbles in a bag is 2:3. The ratio of the number of green marble to the number of blue marbles is 9:4 There are 76 marbles in the bag. a) Find the number of red marbles in the bag.b) Find the number of green marbles in the bag.C) Find the number of blue marbles in the bag///I already did a and b can you guys help me with c/// Endorphins can help reduce stress and are natural painkillers.TrueFalsei think its true? Steam Workshop Downloader