Read the counterclaim to the claim that funding for the space program is important.

While the idea of exploring space is indeed inspiring, critics argue that it’s not financially responsible. They say there are more important things to focus on here on Earth, such as helping people to find jobs and improving their quality of life.

Now read the rebuttal.

With all the problems facing people today, it is understandable that some critics might think that exploring space is foolish and wasteful. But the space industry creates jobs and stimulates the economy.

Luca wants to add one more sentence to the end of the rebuttal so he can fully address the counterclaim. Which would be the best addition to rebuttal?

A In addition, thinking about space exploration makes people feel hopeful and inspired.

B But, some lawmakers are challenging the space agency’s request for a $17.7 billion budget.

C In addition, nine of the twenty-five top scientific breakthroughs in the last twenty-five years came from space exploration.

D Therefore, it is up to the space industry to make its critics understand how useful space exploration is.

Answers

Answer 1

Answer:

C

Explanation:

In addition, nine of the twenty-five top scientific breakthroughs in the last twenty-five years came from space exploration.

Answer 2

The end of rebuttal has been given by, in addition, nine of the twenty-five top scientific breakthroughs in the last twenty-five years came from space exploration. Thus, option C is correct.

For the exploration, counterclaims has been an important part as it has been able to deliver the thought to the exploration for the development of loopholes in the exploration.

The given counterclaim has been against the development of space program. The program has been delivering the idea of space establishment, while counter has been given to focus on important task on earth.

The end of the rebuttal has been based on the positive results with the claim. Thus, the end of claim has been given by, in addition, nine of the twenty-five top scientific breakthroughs in the last twenty-five years came from space exploration. Thus, option C is correct.

For more information about counterclaim, refer to the link:

https://brainly.com/question/10185591


Related Questions




Read the excerpt from The Odyssey.

In a smithy


one sees a white-hot axehead or an adze
plunged and wrung in a cold tub, screeching steam–
the way they make soft iron hale and hard–:
just so that eyeball hissed around the spike.



The use of the epic simile in this excerpt helps the reader understand


that the Cyclops only has one eye.

how brutal Odysseus and his men are.

the size of the wooden spear.

how hot the spear actually is.

Answers

Epic simile, also known as Homeric simile, is a comparison of something using similes that have many lines, not just a couple of words. Here, the use of the epic simile in this excerpt helps the reader understand how hot the spear actually is.
The narrator mentions screeching steam while making a sword, or something like that, when you put a hot piece of metal into water to cool it down, there is a high pitched sound followed by steam. 

Answer:  how hot the spear actually is.

Explanation:

what does bias mean?

Answers

Bias means prejudice in favor of or against a person or thing or group compared with another

Answer:

To favor one thing over another

Explanation:

Determine the type of verbal and how it is used in the sentence for question 10. Carmen enjoys learning about different cultures in South America.

A: participle used as an adjective
B: gerund used as a direct object
C: infinitive used as an adverb

Answers

The answer is: [B]: gerund used as a direct object.
________________________________________
 A participle acts as an adjective, while a gerund acts as a noun.
______________________________________
In the particular sentence given:
_________________________________
"Carmen enjoys learning about different cultures in South America."  ;
_______________________________________________________
the gerund is "learning".
Hi. The answer is B. Gerund used as a direct object c:

Meter and rhyme must be suited to the poem's _____. content theme content, theme, and tone

Answers

Meter and rhyme must be suited to the poem's content, theme, and tone.

Answer:

Content, theme and tone

Explanation:

Meter and rhyme in poetry are similar but not identical concepts. Rhythm refers to the overall tempo, or pace, at which the poem unfolds, while meter refers to the measured beat established by patterns of stressed and unstressed syllables.

Explain the role that the ciil war played in the passage of the 13 amendment

Answers

The civil war was fought for the abolishment of slavery, the 13th ammendment states that slavery or involuntary servitude is alloud unless served as punishment for a crime.

Call me Ishmael. Some years ago—never mind how long precisely—having little or no money in my purse, and nothing particular to interest me on shore, I thought I would sail about a little and see the watery part of the world. It is a way I have of driving off the spleen and regulating the circulation. Whenever I find myself growing grim about the mouth; whenever it is a damp, drizzly November in my soul; whenever I find myself involuntarily pausing before coffin warehouses, and bringing up the rear of every funeral I meet; and especially whenever my hypos get such an upper hand of me, that it requires a strong moral principle to prevent me from deliberately stepping into the street, and methodically knocking people's hats off—then, I account it high time to get to sea as soon as I can. This is my substitute for pistol and ball. With a philosophical flourish Cato throws himself upon his sword; I quietly take to the ship. There is nothing surprising in this. If they but knew it, almost all men in their degree, some time or other, cherish very nearly the same feelings towards the ocean with me. There now is your insular city of the Manhattoes, belted round by wharves as Indian isles by coral reefs—commerce surrounds it with her surf. Right and left, the streets take you waterward. Its extreme downtown is the battery, where that noble mole is washed by waves, and cooled by breezes, which a few hours previous were out of sight of land. Look at the crowds of water-gazers there. Circumambulate the city of a dreamy Sabbath afternoon. Go from Corlears Hook to Coenties Slip, and from thence, by Whitehall, northward. What do you see?—Posted like silent sentinels all around the town, stand thousands upon thousands of mortal men fixed in ocean reveries. Some leaning against the spiles; some seated upon the pier-heads; some looking over the bulwarks of ships from China; some high aloft in the rigging, as if striving to get a still better seaward peep. But these are all landsmen; of week days pent up in lath and plaster—tied to counters, nailed to benches, clinched to desks. How then is this? Are the green fields gone? What do they here?” Carefully reread the following sentence from the passage: “Call me Ishmael.” What inference can be drawn from this passage and its surrounding context? [RL.9-10.1] A. The narrator may not be named Ishmael. B. The narrator may not have been a sailor in the past. C. The narrator may not have even been to Manhattan. D. The narrator may not be recounting true events.

Answers

The correct answer choice is B

The inference that can be drawn from this passage and its surrounding context is, The narrator may not have been a sailor in the past.

What is context?

Context is the factors form the setting of a event or an idea.

Because the passage context shows that he sail for the first time as he quietly take to the ship. As he cherish feelings towards the ocean, and he pent up in lath and plaster—tied to counters, nailed to benches, clinched to desks. And there is nothing in particular to interest him on shore, so he thought he would sail about a little and see the watery part of the world.

Hence the correct option is, B. The narrator may not have been a sailor in the past.

To know more about context:

https://brainly.com/question/8280542

#SPJ3

The impact that the plague pandemic, also known as the black death, had on the people of england in the 1300s

Answers

people had to carry bodies to be buried and some people launched the dead infected bodies over some cities walls. it caused the population to drop dramatically and people left with no where to go.

i need a title for my book. It's about this guys aunt who comes to visit and yells at the boys mother because they didn't know that neither of them knew that their father was dead and the guy knew he just didn't know how to tell them both. That's all I have so far please help me out by giving me a title.
*Thanks to anyone who helps....

Answers

I think a good title would be The Secret. If you wanted to be more specific, you could call it The Secret of ____ (whatever the guy's name is.) Just a suggestion. I love to write stories too. Hope this helps! ^-^

Match each transition with its definition/function in a paragraph.



Match Term Definition
On the contrary A) To compare
In addition B) To show sequence or results
For instance C) To summarize
In conclusion D) To give an example
Afterward E) To add

Answers

Here are the correct definitions :  A, E, D, C, B

On the contrary - To Compare
In addition - To add 
For instance -  To give an example 
Afterward  - To show sequence or results 
I'm sure it helps!

Each transition with its definition/function in a paragraph are:

On the contrary—To CompareIn addition, —To add For instance—To give an example Afterward—To show sequence or results. Thus, option (a), (e), (d), (c), and (b) is correct.

What is sequence?

The term sequence refers to the step by step are to follow. The sequence are to define the chronological in the order. The sequence are the adjusted of the period and the other things of the arranged manner. The sequence of the facts, positions, illustration, and the period.

According to the given data is the match to the proper manner are the arranged to the sequence.

On the contrary—To Compare.In addition, —To add. For instance—To give an example. Afterward—To show sequence or results.

Therefore, option (a), (e), (d), (c), and (b) in the

Learn more about on sequence, here:

https://brainly.com/question/21961097

#SPJ2

The most important details in a text point to the _____
possible answers:
A.publication date
B.central idea
C.parts of speech
D.authors background

Answers

The correct answer that would best complete the given statement above would be option B. CENTRAL IDEA. The most important details in a text point to the central idea. The central idea serves as the unifying element as it serves as the summary of what the given details convey. Hope this answers your question.

Answer:

Central Idea

Explanation:

Took test on EDG

When developing a question for a scientific inquiry, the question will ideally...

A. not just simply ask why.

B. be measurable

C. identify variables

D. all of these

Answers

The three first options are requirements for a scientific inquiry: Not just simply as why, be measurable and identify variables. So the correct option is D. All of these. 

Answer:

Its D I GO IT RIGHT ALL OF THESE

Explanation: STUDY ISLAND

describe Faustus's motivations for learning magic.

Answers

Faustus started learning magic, because he felt that medicine, theology, or the law could do anything for him, or at least what magic could do for him.  

Answer:  The correct answer is : Faust decided to learn magic because he thought that theology, philosophy, law or medicine were useless and could not do anything for him or at least not like magic. He also wanted to learn magic because he is arrogant and proud and thinks that a magician can be considered a semi-god.

Of what should a word conscious writer be aware when choosing between synonyms?
a. nuances of meaning
b. proper spelling
c. etymology
d. standards of practice

Answers

The answer is: [A]: nuances of meaning.
___________________________________________
Note that synonyms are not necessarily interchangeable.

The correct answer is A. Nuances of meaning

Explanation:

In language, there are many words with similar or identical meanings that are called synonyms and are useful for writers to include a variety of words in texts and avoid unnecessary repetition. However, it is common to find nuances of meaning in synonyms which means despite two or more words have similar meanings there are slight differences in meaning and these can affect the meaning of the text. For example, the words house, home, and residence are all synonyms as they represent buildings people use to live but in the case of home this is also link to positive emotions and this difference in meaning can affect texts. Therefore, a writer needs to be aware of the nuances of meaning between synonyms while choosing between them.

Who says the following and why?

[O]f course she's not presentable. She's a triumph of your art and of her dressmaker's; but if you suppose for a moment that she doesn't give herself away in every sentence she utters, you must be perfectly cracked about her.

Answers

Answer:

Mrs. Higgins

Explanation:

Mrs. Higgins is the person who says these lines in the play "Pygmalion" by George Bernard Shaw. When Eliza first arrived to Mr. Higgins house, she was a girl who had no education and was not attractive in the least. However, she is now well-dressed and has a very desirable appearance. However, Mrs. Higgins believes that she is still not presentable. She does not look bad, but she betrays her artificiality the moment that she speaks.

Answer:

Mrs Higgins is scolding her son.

Explanation:

Hi guys... I need to write an essay about a famous soccer player..etc..

What do you know about Robbie Rogers ? (tell me everything you know)
national,girlfirend,etc....

Thank You....
This due tomorrow Saturday morning.

Answers

Nick name is Robert Hampton "Robbie" Rogers III Hes an American Soccer Player.

plays for LA Galaxy in Major League Soccer. He plays as a winger and as a left back. Rogers has also represented the United States men's national soccer team

Born: May 12, 1987 (age 29), Rancho Palos Verdes, CAHeight: 5′ 10″Current team: LA Galaxy (#14 / Midfielder)Parents: Robert Hampton Rogers II, Theresa RogersChildren: Caleb BerlantiSiblings: Katie Rose Rogers, Timothy Rogers, Nicole Camilla Rogers, Alicia Rogers

Passed up his three remaining seasons of eligibility at the University of Maryland to sign with SC Heerenveen, one of the top teams in the Dutch first division, in August 2006. Played with Heerenveen’s reserves, getting time in five games, including three starts, and scoring two goals. Scored his first goal in just his second match with the reserves to help defeat PSV, 3-1, on 9/8. Scored his second goal against FC Twente on 9/26 in a 3-0 win. Secured his release in Feb. 2007 to sign with MLS.

Youth

Was a two-time Parade High School All-American at Mater Dei High School in California.

Answer:

I really dont know much about soccer

Explanation:

Crevecoeur denounces backwoods settlers for their “degeneracy” because he judges them to lack what essential quality that he admires in more settled colonists?

Answers

religion etiquette government industriousness

Answer:

industriousness got it from odyeessywaar

Explanation:

Which sentence offers a better context for the word lunch? Let's have lunch at 1:30 p.m. What are we having for lunch? Lunch was good. My lunch consists of an apple, a sandwich and chips.

Answers

The last one b is correctly correct

Answer:

A. Let's have lunch at 1:30 p.m.

Explanation:

This sentence is the one that offers a better context to understand the meaning of the word "lunch", in case we did not know it, because it indicates a distinctive trait of this meal: It is eaten around midday (1:30 p.m), and the general definition of "lunch" is a light meal usually eaten around midday.

Options B and C are incorrect because they do not provide enough information to infer the word meaning, and option D is also wrong because "an apple, a sandwich, and chips" can be snacks, or evening meals, not necessarily a lunch.

The new government acted more swiftly than the old to secure the rights of the colonists. What is the degree of the adverb more swiftly in the sentence? comparative positive superlative

Answers

Answer:

 

comparative

Explanation:

 

Answer:

Comparative

Explanation:

Comparative adverbs show similarities or dissimilarities between two things or people. They are formed by adding the “-er” ending to the adverb to compare (usually when it is one-syllable adverb), or using “more” + the regular form of the adverb (usually when it is an adverb of two or more syllables like “swiftly”).  

In the sentence, “more swiftly” is acting as a comparative adverb because it shows a difference between two things: the new government and the old one.

Read the line from President Reagan’s Address at Moscow State University. Go into any schoolroom, and there you will see children being taught . . . certain unalienable rights—among them life, liberty, and the pursuit of happiness.
What is the purpose of this line? to entertain readers with a story about children
to inform readers about American schools
to instruct readers in educational techniques
to persuade listeners of the importance of freedom

Answers

The correct answer of the given question above would be the last option. Based on the given line from President Reagan’s Address at Moscow State University, the purpose of the line is to persuade listeners of the importance of freedom. Hope this is the answer that you are looking for. Have a great day!

Answer:

to persuade listeners of the importance of freedom

Explanation:

Reagan adressed this speech during the cold war in Moscow university where he was going to meet Gorbachev, he was trying to persuade the young soviets to think and to demand freedom from their government and to try to put in their minds the idea that maybe their education was wrong.

Which incident helps to support the following inference: Virgil protects Dante as he makes his journey
A)Dante's encounter with the uncommitted in the vestibule of hell
B)Dante's encounter with Charon
C)Dante's encounter with Beatrice
D)Dante's encounters with sinners in the various rings of hell

Answers

I believe that the incident which helps to support the inference that Virgil protects Dante as he makes his journey is the last option - D. Dante's encounters with sinners in the various rings of hell. 
There was no danger when he encountered the uncommitted, Beatrice, or Charon, whereas there were dangers with some other "residents" of hell. 

Answer:

Dante’s encounters with sinners in the various rings of Hell

Explanation: ODYSSEY WARE

. This version of Grendel is more ________ than the version in John Gardner’s novel

Answers

In the original tale of Beowulf, Grendel was purely a monster. Gardner's novel focuses on the part of the original Anglo-Saxon epic that points out Grendel came of "the race of Cain"--in other words, he was a human being, but cursed. Gardner's Grendel imagines what it must have been like to be Grendel, capable of human thought and speech and feeling, but treated as vermin, the ultimate vengeful outcast. It uses Grendel's point of view to ask the question, "What does it mean to be human?"

Answer: A- Vicious

Explanation: Grendel is considered the first and most terrifying monster in English literature. This a postmodern work that is near to the classicism.

What is the direct object in the sentence?

The spider spun a web across our porch.

A.
web

B.
spider

C.
spun

D.
porch

Answers

The web would be the direct object, because the direct of a sentence receives the action of the verb. 

Which excerpt from "Initiation” correctly matches with the implied resolution of the story?

Answers

The excerpt from "Initiation" that correctly matches with the implied resolution of the story would be this: "It won't be any different with us, Tracy," Millicent had told her; This is the rising action implying that the two girls will remain friends. Hope this answer helps. 

Answer:

B on edge

Explanation:

Why does Claudius cry out for more LIGHT when he is watching the play within the play?

Answers

Final answer:

Claudius calls for more light to escape the emotional discomfort caused by a play that mirrors his own guilt, a literary motif where light represents truth and knowledge.

Explanation:

Claudius' demand for more light during the play within the play in Shakespeare's Hamlet is a response to the psychological and emotional discomfort he experiences as the performance mirrors his own heinous actions. The metaphorical light in literature often symbolizes truth and knowledge. In this context, calling for physical light can be seen as an attempt to escape the revelation of truth, as Claudius' guilt is illuminated by the plot of the play. This mirrors the use of light as a symbol in various literary texts, where characters seek or shun light based on their comfort with the truth it represents.

Which of the following steps in the discussion process helps you identify the strengths and weaknesses of various ideas?

A. gathering ideas

B. agreeing on a single idea

C. setting a time limit

D. analyzing ideas

Answers

D is the correct answer

The correct answer is D. Analyzing ideas

Explanation:

The term discussion or group discussion refers to the communicative situation in which two or more individuals share ideas and information in order to achieve a goal, for example finding a solution or just share similar and opposite points of view. Because of this, discussions follow a process that includes allowing all the participants to introduce themselves; agreeing on the rules or steps that the discussion will follow including the time limit; introduce the topic; let the participants ask questions and share ideas; gathering the ideas proposed; analyze the ideas in order to find the most relevant ideas or idea and wrap-up the discussion by agreeing on a final idea or ideas.

In the case of analyzing ideas step, the ideas proposed by the different participants are evaluated in order to know their advantages or strengths and their disadvantages or weaknesses to finally decide on the best idea or ideas that are part of the conclusion or wrap-up of the discussion and that are necessary in case the discussion aims at solving a problem. Considering this, the step of the discussion process that helps you identify the strengths and weaknesses of various ideas is analyzing ideas.

Read the excerpt from The Remains of the Day by Kazuo Ishiguro. Based on sentence structure, what is the pacing of the excerpt? Why?

For the truth was, it was extremely refreshing to be out in the summerhouse after many continuous days in the main building and neither of us was inclined to hurry with our tasks. Indeed, although one could not see out far that day on account of the encroaching mist, and the daylight too was rapidly fading by this stage, . . . I remember our often breaking off from our respective activities simply to gaze out at the views around us.

1) leisurely; to reflect the exciting situation described
2) fast-paced; to reflect the exciting situation described
3) leisurely; to reflect the relaxed situation described
$) fast-paced; to reflect the relaxed situation described

Answers

The best and most correct answer among the choices provided by the question is the third choice or number 3.

The excerpt was leisurely; to reflect the relaxed situation described.
I hope my answers has come to your help. God bless and have a nice day ahead!

Answer:

The pacing of this excerpt from The Remains of the Day by Kazuo Ishiguro is leisurely; to reflect the relaxed situation described. The correct answer is number 3.

Explanation:

Along all the passage, the speaker tells with calm what they did at the summer house. The speaker expresses with pause that, although they had tasks to do, they weren't in a hurry, they could enjoy the view and peacefulness the place gave them. The pace of this excerpt is leisurely and it transmits peace.

When using quotes in your literary analysis essay, you should

A. make your quotes long and complete. Include as much of the original text as possible.
B. make your quotes always short – only a word or two of quoted material at a time.
C. make your quotes only as long as needed to support your point.

Answers

The answer is: [C]: make your quotes only as long as needed to support your point.
___________
Note: One should not "pad" one's essay with irrelevant, superfluous matter.

Which best explains how the structure of this text might affect your comprehension?

Answers

What text? you need to add more detail to your question for us to try and help you.


A responsible search for a rental property will include all of the following EXCEPT:
A.a careful search of available properties using newspapers, finder services, bulletin boards, or the Internet
B.consideration of transportation routes and what to be close to
C.quickly renting the first place that comes up in a search
D.identifying a maximum rent that is affordable

Answers

Answer:

A responsible search for a rental property will include all of the following EXCEPT quickly renting the first place that comes up in a search

Explanation:

Looking for a place for rent can be quiet exhausting. One has to keep a lot of points into consideration before finally selecting a place. A person shall always start with looking for the available choices in a newspaper or internet as they will provide the best options. Secondly, the person should always have his/her budget in mind. If the rental place is beyond your expenses, this would mean cutting off on a lot of other things just to pay house rent. Also, a person should look for a place that is nearest to places he/she has to travel to every day.

Hence, all other options are correct other than option C.

What to capitalize:
many potatoes are grown in aroostook county, maine, and in prince edward county.

Answers

Aroostook County, Maine, Prince Edward County

Final answer:

The words 'Many,' 'Aroostook County,' 'Maine,' and 'Prince Edward County' should be capitalized, following the rules for capitalization of the first word of a sentence and proper nouns.

Explanation:

When considering what to capitalize, you will need to remember a few key rules. According to the mechanics of capital letters (H 10.), certain items in sentences should always be capitalized. This includes the first word of a sentence, proper nouns, and proper adjectives. Therefore, in the sentence you provided, the capitalized version would be: 'Many potatoes are grown in Aroostook County, Maine, and in Prince Edward County.' Here, 'Many' is capitalized because it is the first word of the sentence, and 'Aroostook County', 'Maine', and 'Prince Edward County' are capitalized because they are proper nouns. So, the correct sentence with capitalization would be: Many potatoes are grown in Aroostook County, Maine, and in Prince Edward County.

Other Questions
30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period Algae uses all the energy in sunlight to perform photosynthesis.true or false what is 2 1/2 divided by 1/3 The ratio of the number of red marbles to the number of green marbles in a bag is 2:3. The ratio of the number of green marble to the number of blue marbles is 9:4 There are 76 marbles in the bag. a) Find the number of red marbles in the bag.b) Find the number of green marbles in the bag.C) Find the number of blue marbles in the bag///I already did a and b can you guys help me with c/// Endorphins can help reduce stress and are natural painkillers.TrueFalsei think its true? What was the purpose of having a cabinet?to use people outside of politics for adviceto assist the president in making decisionsto tell the president what to do The price of an item has been reduced by 70% . The original price was $60 . What is the price of the item now? Healthy bones, teeth, and muscles require the mineral?CarbonSodiumCalciumCadmiumIron Steam Workshop Downloader