The phone company charges 10 cents to connect a call for one minute, and 8 cents per minute after that. How long could you talk on the phone for $1?

Answers

Answer 1
you can talk on the phone for 12 minutes for $1

Related Questions

which Statement describes what these four powers have in common? 4^0 (-2)^0 (1/3)^0
A. all the powers have a value a value of 0 because the exponent is zero
B. all the powers have the value of 1 because the exponent is zero

Answers

the answer would be B) all the powers have the value of 1 because the exponent is zero

Answer:

Option B is correct

all the powers have the value of 1 because the exponent is zero

Step-by-step explanation:

Using the exponent rule:

[tex]a^0 = 1[/tex] for any real number a.

Given that:

[tex]4^0 = 1[/tex]

[tex](-2)^0 = 1[/tex]

[tex](\frac{1}{3})^0 = 1[/tex]

⇒all the powers have the value of 1 because the exponent is zero

Therefore, the  Statement describes what these four powers have in common is, all the powers have the value of 1 because the exponent is zero

Hey principal evenly distribute six copies of paper to eat fifth grade teachers. How many copies of paper does the fifth graders teachers receive.

Answers

okay if there are 8 teachers and 6 reams of paper you would have to divide 6 by 8 and you would get 0.75

6/8= 0.75

each teacher would get 0.75 (3/4) of a ream of paper

Solve each equation. Check your solution.

3 1/10s = 6 1/5 = ?

2 2/9 = -4/5m = ?

-2 4/5 = -3 1/2n = ?

Answers

converting all to improper fractions
31/10s = 31/5
5×31s=31×10
155s = 310
s=310/155= 2


20/9=-4/5m
5×20=-4×9m
100=-36m
m=100/-36 = 72 28/36 = 72 7/9


-14/5=-7/2n
-14×2=5×-7n
-28=-35n
n =-28/-35
n=28/35

PLS HELP ME ASAP algebra

Answers

It is 2n+2. 5n - 3n = 2n.
It's 2n+2. Because you add like term

1. Write 6 less than the product of 2 and x as an algebraic expression

2. Write 3xxyyy using exponents

Answers

1. 2x-6

2. 3x^2y^3

Those should be the answers, I am 100% sure number 2 is correct and number 1 should be as well

this unit is functions can you tell me rhe pints to graph with the picture?

Answers

a) f(x) + 2: shift the graph 2 units upward

b) f(x - 4): shift the graph 4 units rightward

c) f(-x) - 5: reflect accross the y -axis and shift 5 units dwonward

d) - f(x + 3): shift 3 units leftward and reflect accross the x-axis

e) 2f(x): scale by 2, this will. enlarge the graph vertically

f) f(1/3x): scale by factor 1/3, this will enlarge the graph horizontally

g) f(x - 1) + 3: shift the graph 1 unit rightward and 3 units upward

g) f(2x) - 4: scale the graph by 2 and shift the graph 4 units leftward

the graph shows the height of 10 sunflower grown in pjs garden

Answers

i think it is 1/2. (just filling the 20 characters now)

Answer:

B. [tex]\frac{1}{2}[/tex]

Step-by-step explanation:

We have been given a graph that shows the height of the 10 sunflowers grown in PJ's garden. We are asked to find the probability that the 11th flower will be at least 60 inches.  

[tex]\text{Probability}=\frac{\text{Total number of favorable outcomes}}{\text{total number of possible outcomes}}[/tex]

From the given experiment we can see that there are 5 sunflowers with height more than or equal to 60 inches, so total number of favorable outcomes is 5.

Since there are total 10 sunflowers, so total number of possible outcomes is 10. Upon substituting our given values in probability formula we will get,

[tex]P(\text{The 11th plant will be at least 60 inches})=\frac{5}{10}[/tex]

[tex]P(\text{The 11th plant will be at least 60 inches})=\frac{1}{2}[/tex]

Therefore, the probability that 11th plant will be at least 60 inches is [tex]\frac{1}{2}[/tex] and option B is the correct choice.

how much will 167 go into 44756

Answers

44,756 divided by 167 is 268.

167 will go into 44756 exactly 268 times, I hope this helps


Help me plz asap i need the first question dont answer till u see file

Answers

okay, so with the link we can tell this:

flour and baking soda are equal ratios
salt is one half the ratio of flour/baking soda

A: correct
flour and baking soda as equal ratios

B: incorrect
salt is at an incorrect ratio to flour

C: correct 
salt is at a correct ratio to baking soda

D: incorrect
salt is at an incorrect ratio to baking soda

E: correct
baking soda is at a correct ratio to salt

answers: A, C , E

Team Tool Bella canoed 15 3/4 miles in 5 1/4 hours. What was their average speed in miles per hour

Answers

Thee miles per hour

we know that

To find the average speed divide the total distance by the time

In this problem we have

[tex]total\ distance=15\frac{3}{4}\ miles[/tex]

[tex]time=5\frac{1}{4}\ hours[/tex]

Convert mixed numbers to an improper fractions

[tex]total\ distance=15\frac{3}{4}\ miles=\frac{15*4+3}{4} =\frac{63}{4}\ miles[/tex]

[tex]time=5\frac{1}{4}\ hours=\frac{5*4+1}{4} =\frac{21}{4}\ hours[/tex]

Divide the total distance by the time

[tex]\frac{(63/4)}{(21/4)} =\frac{63}{21} =3\frac{miles}{hours}[/tex]

therefore

the answer is

the average speed is  [tex]3\frac{miles}{hours}[/tex]



Which set is a function?

A)
{(0,3), (3,0), (0,4), (4,0)}


B)
{(0,2), (2,0), (4,6), (6,4)}


C)
{(2,6), (3,6), (4,6), (2,0)}


D)
{(6,2), (2,0), (4,6), (6,4)}

Answers

b, short explanation remember the sets are set up like (x,y) in a set there should be no matching x points so if it matches it's not a function :)

long explanation: these are (x,y) sets {(0,3), (3,0), (0,4), (4,0)} the first choice shows that there are two X solutions if they are equal to 0 (0,3) (0,4) so this cant be a function.

second choice {(0,2), (2,0), (4,6), (6,4)} does not have two X solutions so this is a function
third choice{(2,6), (3,6), (4,6), (2,0)} has two X solutions if x is equal to 2
and the last choice {(6,2), (2,0), (4,6), (6,4)} has two X solutions if x is equal to 6
hope i helped! if i did please give me brainlest :)

Final answer:

Set B is the only set that represents a function.

Explanation:

A function is a relation in which each element of the domain is mapped to a single, unique value in the range. In set A, there are two distinct ordered pairs with the same first element, making it not a function. In set B, each member of the domain occurs in just one ordered pair, making it a function. Therefore, set B is the only set that represents a function.

1. In △ABC, GE=27 in.

What is the length of BE¯¯¯¯¯?

2. In △JKL, LO=104 cm .

What is the length of NO¯¯¯¯¯¯?

3. In △RST, SU=45 in.

What is the length of UX¯¯¯¯¯¯?

1.  81
2. 52
3. 15

Answers

1. In △ABC, GE=27 in.

BE = 3(27) = 81

What is the length of BE¯¯¯¯¯?
answer
1.  81

2. In △JKL, LO=104 cm .
NO = 1/2(LO) = 1/2(104) = 52

What is the length of NO¯¯¯¯¯¯?

answer
2. 52

3. In △RST, SU=45 in. 
UX = 1/3(SU) = 1/3(45) = 15

What is the length of UX¯¯¯¯¯¯?
answer

3. 15

there are 6 photos on the wall.there are 2 photos in each row. how many rows of photos are there

Answers

There are 3 rows of pictures on the wall because 2 times 3 is 6
Final answer:

There are 3 rows of photos on the wall.

Explanation:

To determine the number of rows, we need to divide the total number of photos by the number of photos in each row. In this case, there are 6 photos and 2 photos in each row. So, we divide 6 by 2:

6 ÷ 2 = 3

Therefore, there are 3 rows of photos on the wall.

Learn more about Number of rows of photos here:

https://brainly.com/question/805503

#SPJ2

Least to greatest: 0.003, 3%, 3/10,3x10

Answers

.003, 3% (.30), 3/10(30), 3x10(30)
They were already in order.
0.003, 3%, 3/10, 3 x 10

0.003,

3% = 0.03

3/10 = 0.3

3 x 10 = 30

0.003, 3%, 3/10, 3 x 10 is your answer

hope this helps

Every week, Mr. Kirkson uses 316 gallon of water to water every 13 square foot of his garden.How many gallons of water does Mr. Kirkson use per square foot to water his garden each week?

Enter your answer in the box as a fraction in simplest form.

Answers

24 4/13 gallons are used to water one square foot of his garden.

Use the figure to complete the sentence.

∠6 and ____ are corresponding angles.

∠2
∠3
∠7
∠8

Answers

i think 2 is the answer i might be wrong

Answer:

Its 2

Step-by-step explanation:

i did the test :)

Divide.

−513÷234

−1256

−7512

−13133

−11112

Answers

Answer:

2.19, -1,253, -8,765, -21,898, -33,010

Step-by-step explanation:

Answer: The answer is not 2.19, -1,253, -8,765, -21,898, -33,010 it is -1 31/33

Step-by-step explanation: This question was on my quiz and I got it right.

How do I solve this?

Answers

First, you isolate the absolute value.

4 + 8|2b| = 84

8|2b| = 80

|2b| = 10

Now to solve the absolute value part, set what is inside the absolute value equal to 10 and set it equal to -10 and solve both equations.

2b = 10   or   2b = -10

b = 5   or b = -5

Omar owns a sandwich shop, and his best selling sandwich is the BLT. When making BLT sandwiches, it takes 3/4 of a pound of bacon to make 4 sandwhiches. he uses 1 1/20 pounds of bacon for every 2 tomatoes used and 5 tomatoes for every full head of lettuce used. If Omar is making enough BLT sandwiches to use 2 full heads of lettuce, then he is going to use blank pounds of bacon and will make a total of blank blt sandwiches.

Answers

Answer:

He is going to use 21/4 pounds of bacon.

He will make a total of 28 BLT sandwiches.

Step-by-step explanation:

It is given that:

for every full head of lettuce used the number of tomatoes used are: 5

This means that when he used 2 full heads of lettuce then the number of tomatoes which are used are: 10

( since for 1 head of lettuce --- 5 tomatoes are used.

and for 2 head lettuce---- 5×2=10 tomatoes are used )

Now, it is given that for every two tomatoes used 1 1/20 pounds of bacon is used.

i.e. for every 2 tomatoes --  21/20 pounds of  bacon is used.

Hence, for 1 tomato---   (21/20)×(1/2) pound of bacon is used.

i.e. for 1 tomato ---- 21/40 pound of bacon is used.

Hence, for 10 tomatoes ---(21/40)1×10 pounds of bacon is used.

i.e. for 10 tomatoes ---- 21/4 pounds of bacon is used.

Now, it is given that:

with the help of 3/4 pounds of bacon 4 sandwiches are made.

Hence, with the help of 1 pound of bacon  16/3 sandwiches will be made.

Hence, with the help of 21/4 pounds  of bacon  (16/3)×(21/4) sandwiches could be made.

i.e. with the help of 21/4 pounds of bacon 28 sandwiches could be made.

Final answer:

To calculate the amount of bacon Omar will use to make BLT sandwiches and the total number of sandwiches, we follow the given conversion factors. We set up proportions to find the amount of bacon used for the total sandwiches and the two full heads of lettuce. The total number of sandwiches is found by dividing the number of tomatoes by 5.

Explanation:

To calculate the amount of bacon Omar will use to make BLT sandwiches and the total number of sandwiches, we need to follow the given conversion factors. 1. For every 4 sandwiches, 3/4 of a pound of bacon is used. So, we can set up a proportion: 3/4 pound / 4 sandwiches = x pound / total sandwiches. Solving for x will give us the amount of bacon used for the total sandwiches. 2. For every 2 tomatoes, 1 1/20 pounds of bacon is used. Since Omar is using 5 tomatoes for two full heads of lettuce, we can set up another proportion: 1 1/20 pounds / 2 tomatoes = x pound / 5 tomatoes. Solving for x will give us the amount of bacon used for the two full heads of lettuce. To find the total amount of bacon used, we add the amount used in the sandwiches to the amount used for the lettuce. Finally, the total number of sandwiches can be found by dividing the number of tomatoes by 5.

What is the slope of this line?

Answers

The slope should be y = -1.
so you would look at the axis (it says it there).
since it is closer to nine, the answer would be nine.
In the negative section I think it is -10. It is close.
Hope this helped :D

How do you solve 2x cubed + 3x squared -2x -3 = 0

Answers

4x + y = 3y = -4x + 32x + y = -5y = -2x - 52x + 3y = 9y = -2/3x + 33x + 4y = -8y = -3/4x - 24x - 2y = 10y = 2x - 5-6x + 4y = -8y = 3/2x - 24x - y = 3y = 4x - 33x - y = -8y = 3x + 82x - 4y = 4y = 1/2x - 12x - 5y = 15y = 2/5x - 3What is a rational number?Any number that can be written as a fraction.What is an irrational number?A number that goes on forever and has no pattern.How do you write a repeating decimal as a fraction?Put a 9 under the repeating digit. (One 9 for every repeating digit)What is a square root?When a number is multiplied by itself to make another number. Ex: The square root of 49 is 7, because 7*7=49What are the first 10 perfect squares?1, 4, 9, 16, 25, 36, 49, 64, 81, 100How do you multiply powers with the same base?Add the exponents and keep the base the same.How do you divide powers with the same base?Subtract the exponents and keep the base the same.What do you do with a negative exponent?Flip the number to the other side of the fraction and make the exponent positive.How do you raise a power to another power?Multiply the exponents.What is any number raised to the 0 power?1How do you find the slope of a line on a graph?Pick two points and find rise over run.How do you find the slope of two points?Find how much the y changes over how much the x changes.How do you find the slope of a table?Find how much the y changes over how much the x changes.When you write an equation in y=mx+b form, what does the m stand for?Slope


Solve for x:

negative 3 over 2, multiplied by x minus 9 equals negative 27

−24

−12

11

12

Answers

-3x/2 - 9 = -27
-3x/2 = -27 + 9
-3x/2 = -18
-3x = -18 * 2
-3x = -36
x = 36/3
x = 12

*negative thirty-six turned into negative thirty-six over three, but since both numbers were negative, we had to make it positive in order to simplify, so that's why the answer is twelve, and not negative twelve.

Answer:

x=12

Hope this helps :)

Jami jogged 1/3 of a mile in 1/6 of an hour. What was her speed in miles per hour?

Answers

there are 6  1/6 per hour

multiply 1/3 by 6

1/3 * 6 = 6/3 = 2 miles per hour

One weekend, Nate compared his history homework to his younger sister Caroline’s social studies homework. He found that for every 2 1−3 pages he had to read for homework, Caroline had to read one page for homework. How many pages did Nate read for every three pages Caroline read?

Answers

In my calculations he would have to read 6 to 8 pages 


Hope this helped! :)

he read  2 1/3 pages to her one

so 2 1/3 * 3 =

7/3 * 3 = 21/3 = 7 pages

Hhhhhhheeeeeeelllllllppppppp

Answers

the answer is -4/10y + 3
hope this helped!!!!

All of the following expressions are equivalent except _____.

2 - x
x - 2
-2 + x
x + (-2)

Answers

2 - x. because if you replace the x with any number you will get the same answer except for in 2-x. Ex

2 - 4 = -2

4 - 2 = 2

-2 + 4 = 2

4 + (-2) = 2

Hello! Your answer would be A. 2 - x.

God bless! :)

Erase 3/5 of the shape part below. How much of the original figure will be shaded?

Answers

Okie doke. So, to find what 3/5 of the shape would be above, we should do 2/3 * 3/5. When you multiply straight across, you get 6/15 or 2/5 in simplest form. 2/5 of the original figure will be shaded after you erase 3/5 of the shaded part. The answer is 2/5.

The amount of the original figure shaded is 4/15

How to find how much left

In the figure the shaded part is 2/3.

To remove or erase 3/5 of the shaded part we find the 3/5 and subtract it

= 3/5 * 2/3

= 6/15

how much of the shaded figure left

= 2/3 - 6/15

= 4/15

The amount of the original figure shaded is 4/15

Learn more about shaded part  fractions

https://brainly.com/question/35893917

#SPJ2

In mr. Klein's class, 40% of the students are boys. What decimal represents the portion of the students that are girls

Answers

I think the answer is .6, because if 40% of the students are boys, then 60% of the students are girls. 60% as a decimal is .6. Hope this helps!

The percentage of students that are girls in Mr.Klein's class is 60 % and the decimal value is 0.6

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

Let the total number of boys in the class be = A

Let the total number of girls in the class be = B

Now , the percentage of students in the class that are boys = 40 %

So , ( 40/100 ) of the students are boys

A = 40/100

A = 0.4

Now , the remaining students in the class are girls

So , 100 - 40 = 60

The percentage of students in the class that are girls = 60 %

So , ( 60/100 ) of the students are girls

B = 60/100

B = 0.6

Hence , The percentage of students that are girls in Mr.Klein's class is 60 % and the decimal value is 0.6

To learn more about equations click :

https://brainly.com/question/10413253

#SPJ5

what is 1.59 in expanded form

Answers

I believe this would be 1+.0.5+0.9
hope this helps!
1.59= 1.0+0.50+0.09 will be correct answer


Which product is negative?

−4⋅(−6)⋅(−3)⋅(−5)
−3⋅5⋅(−6)⋅4
−7⋅(−3)⋅(−9)⋅0
−3⋅4⋅(−2)⋅(−7)

Answers

negative

answer

−3⋅4⋅(−2)⋅(−7)
The last expression is negative. The first and second are positive, because there are an even amount of negative digits. The third expression equals to zero, which is neither negative or positive. The last expression is negative because there is an uneven number of negative digits. It's the same reading why any negative number to the power of 2,4,6,8,..., is positive and any negative number to the power of 1,3,5,7,9,..., is negative
Other Questions
((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Why is it important that melanin is present in its highest concentration in the keratinocytes at or near the basale layer of cells? Steam Workshop Downloader