What is the least common denominator (LCD) of 1/2 and 3/5 ?

Answers

Answer 1
Im pretty its 1 and 5


Related Questions

Dani is working a sample booth at the national soda and beverage convention. She is paid $1.50 for each of the first ten tastings $2.50 for each of the next twenty tastings and $4.00 for each tasting beyond thirty she conducts each day. Today Dani conducted 36 tastings. How much total pay did Dani earn today?

Answers

She conducted 36 tastings.

10 tastings are in the category of the first 10 tastings.
10 * $1.50 = $15.00

36 - 10 = 26
Out of the remaining 26 tastings, 20 are int eh category of "the next 20 tastings."
20 * $2.50 = $50.00
This accounts for 10 + 20 = 30 tastings.

36 - 30 = 6
She did 6 tastings beyond the 30 tastings, so for the last 6 tastings, she gets paid
6 * $4.00 = $24.00

The total pay is:
$15.00 + $50.00 + $24.00 = $89.00

The blade of a circular saw rotates at a rate of \2500 revolutions per minute. what is the linear velocity in miles per hour of a point on the tip of the outer edge of a 7 and one fourth7 1 4 inch diameter​ blade?

Answers

The answer to this question is 0.276miles for hour
Final answer:

The linear velocity of a point on the tip of the outer edge of the circular saw blade is 0.429 miles per hour.

Explanation:

To find the linear velocity of a point on the tip of the outer edge of the circular saw blade, we can use the formula:

Linear velocity = 2 * π * radius * angular velocity

Where the radius is half of the diameter. Given that the diameter is 7 1/4 inches, the radius is 7 1/4 / 2 = 3 5/8 inches or 3.625 inches. Converting this to feet, we get 3.625 / 12 = 0.302 feet. To convert the angular velocity from revolutions per minute to radians per second, we multiply by 2 * π / 60. Substituting these values into the formula, we get:

Linear velocity = 2 * π * 0.302 * (2500 * 2 * π / 60) = 37.699 feet per minute.

To convert this to miles per hour, we divide by 5280 (since there are 5280 feet in a mile) and multiply by 60 (since there are 60 minutes in an hour):

Linear velocity = (37.699 / 5280) * 60 = 0.429 miles per hour.

Luis makes $23.10 per hour at his job for the first 40 hours he works each week. if he works more than 40 hours, then luis makes $34.65 per hour. if luis works 46 hours in one week, how much does he earn?a.$1,062.60b.$1,097.25c.$1,131.90d.$1,593.90

Answers

The answer is $1593.90

Answer:

correct answer is C. Just took the test.


The graph of a line goes up and to the right when

Answers

it has a positive slope.

Answer: When the coefficient of X is positive!

(99 POINTS AVAILABLE)
When three or more lines intersect at one​ point, the point of intersection is called the​ ____________.

Answers

When three or more lines intersect in one point, they are concurrent. The point at which they intersect is the point of concurrency.
The point of concurrency. Hope it helps!

The length of a rectangle is 4 inches more than its width. the perimeter of the rectangle is 32 inches. what is the length of the rectangle

Answers

the length is 10 width is 6
2(10+6) =32

12 is 30% of blank plz give the right answer

Answers

12 is 30% of the number 40.



12/x equals 30/100. So 12 times 100 equals 1200 divided by 30. The answer is 40.

Please do not make into a fraction because I can’t use a fraction as an answer. Rewrite using a negative exponent.
1/(xy)^1

Answers

[tex]\bf \left.\qquad \qquad \right.\textit{negative exponents}\\\\ a^{-{ n}} \implies \cfrac{1}{a^{ n}} \qquad \qquad \cfrac{1}{a^{ n}}\implies a^{-{ n}} \qquad \qquad a^{{{ n}}}\implies \cfrac{1}{a^{-{{ n}}}}\\\\ -------------------------------\\\\ \cfrac{1}{(xy)^{+1}}\implies (xy)^{-1}[/tex]

Staci is attending a music festival. The ticket to the festival costs 87.96. Staci plans to purchase 30.00 t-shirts from the event for close friends. She is taking 200.00 to the festival . What is the maximum number of t-shirts Staci can purchase?

Answers

Initial cash on hand : $200.00
Ticket cost : $87.96
T-shirt cost per piece: $30.00

The first thing Staci needs to do is to deduct the cost of the ticket from her money.

$200  - 87.96 = $112.04

Stacy has the extra amount of 112.04 to purchase t-shirts. Since, each t-shirt costs $30. To know the number of shirts she can buy, she must divide the difference by 30.

$112.04 / $30 = 3.73

Based from the quotient, Stacy can buy 3 t-shirts.

$30 * 3 = $90 total cost of the tshirts.

$112.04 - 90 = $22.04

After buying the ticket and 3 tshirts, Staci has an excess of $22.04 from her $200.

Hope this helped

Final answer:

Staci can purchase a maximum of 3 T-shirts after buying her festival ticket, given she brings $200.00 and each T-shirt costs $30.00.

Explanation:

To calculate the maximum number of T-shirts Staci can purchase at the music festival, we can follow these steps:

Subtract the cost of the festival ticket from the total amount of money Staci is taking to the festival. This will give us how much money she has left for the T-shirts.

Divide the remaining amount by the cost of one T-shirt to find out the maximum number of T-shirts she can buy.

So for the first step:

Staci has $200.00 and the ticket costs $87.96, leaving her with $200.00 - $87.96 = $112.04.

For the second step:

Each T-shirt costs $30.00, so we divide $112.04 by $30.00, which gives us 3.734.

Since Staci cannot buy a fraction of a T-shirt, we round down to the nearest whole number, which is 3.

Therefore, the maximum number of T-shirts Staci can purchase is 3.

What is 2(6+5•2)=5(4-2•5)

Answers

32=-30 
..................................

Answer: Not true

Step-by-step explanation: 2(16)=5(-6)

32=-30

This is not true

Alberto, Carlos and Maria share an inheritance of $54000 in the ratio of 3: 4: 5
What fraction of the the money does Alberto get?

Answers

Do 3x+4x+5x=54000
12x=54000
X=4500
Now im not sure which is alberto but if they are in the order as listed he would be 3.
So alberto = 3x
Alberto= $13500

Alberto gets [tex]\( \frac{1}{4} \)[/tex] of the inheritance.

To find out the fraction of the money Alberto gets, we first need to find out how much of the total inheritance each part of the ratio represents.

The total parts in the ratio are [tex]\(3 + 4 + 5 = 12\)[/tex].

Alberto's share is [tex]\(3\)[/tex] parts out of [tex]\(12\)[/tex].

So, Alberto's share of the inheritance is [tex]\( \frac{3}{12} \)[/tex] of the total amount.

To simplify this fraction, we can divide both the numerator and the denominator by their greatest common divisor, which is [tex]\(3\)[/tex]:

[tex]\( \frac{3}{12} = \frac{1}{4} \)[/tex]

Therefore, Alberto gets [tex]\( \frac{1}{4} \)[/tex] of the inheritance.

A scatter plot has been created with a line of best fit that matches the equation y = 11x + 340. Using this line of best fit, determine the output value when the input is 10. Do you think this matches a point on the scatterplot? Why or why not?

Answers

For the fist part you simply substitute 10 in for x to the equation to get the corresponding y value

y = 11(10) + 340
y = 110 + 340
y = 450

For the second part of that question, do you think this matches a point on the scatterplot.....more than likely this is a NO, as generally speaking a line of best fit doesn't pass through many of the data points that it uses to create the equation for the line, so I'd say probably not.

Hope this helps.

Brian
I got 450 with the input of the equation I don't have the proper calculator to do the scatterplot

A friend creates an IRA (Individual retirement account) with an APR of 6.25%. She starts the IRA at the age of 25 and deposits $50 at the end of each month. How much will her IRA contain when she retires at the age of 65?

Answers

65 - 25 = 40
so

A = [P (1 + i/n)^nt - 1 ] / (i/n)
A = [50 (1 + 0.0625 / 12)^12*40 - 1] / (0.0625 / 12)
A = $106,596

answer
$106,596

bh+hr=25
solve for h and r

Answers

Take h common:

h(B + r) = 25

Divide b+r
h = 25/ b + r


Subtract bh:

hr = -bh + 25

Divide h:

r = -bh/h + 25/h

Simplify:

r = -b + 25/h

Hope this helps!

Final answer:

To solve for h and r in the equation bh + hr = 25, isolate one variable, solve for h using division, and solve for r by expanding the equation. There is no unique solution for h and r in terms of each other.

Explanation:

To solve for h and r in the equation bh + hr = 25, we need to isolate one variable on one side of the equation. Let's solve for h first:

bh + hr = 25

Factor out h from the left side of the equation:

h(b + r) = 25

Divide both sides by (b + r) to solve for h:

h = 25 / (b + r)

Now, let's solve for r. Replacing h in the original equation:

bh + hr = 25

b(25 / (b + r)) + r(25 / (b + r)) = 25

Multiply both sides by (b + r) to get rid of the denominators:

25b + 25r = 25(b + r)

Expand the equation:

25b + 25r = 25b + 25r

As we can see, the equation is an identity, meaning any value of r will satisfy it. Therefore, there is no unique solution for r in terms of h, and vice versa.

Learn more about Solving equations here:

https://brainly.com/question/14410653

#SPJ3

While catching fireflies, you and a friend decide to have a competition. after mm minutes, you have (3m+13)(3m+13) fireflies and your friend has (4m+6)(4m+6) fireflies.
a. how many fireflies are caught each minute during the competition?

Answers

To find for the number of fireflies caught in a minute, we simply look at the equation. The equation is linear and takes the form y = slope * x + b

where slope is also equivalent to the fireflies caught each minute.

So the equation of you and your friend is: (where y is the total fireflies caught)

 

you:

y = 3 m + 13

 

your friend:

y = 4 m + 6

 

So the fireflies caught each minute is:

you: 3

your friend: 4

 

So a total of 7 fireflies each minute combined

What type of angles are 6 and 8?

Answers

These angles are called vertical angles. They will always be equivalent with each other.
These angles are called vertical angles.They will always be equivalent with each other and yes that’s the right answer smart cookie

willie wants to save for a new racing bike. if he deposits $250 in a saving account at 4% simple annual interest, what willis balance be after 3 years?
A.15
B.30
C.265
D.280

Answers

To find how much he gets a year, we multiply 250 by 0.04. He gets 10 dollars the first year. for year 2, we multiply 260 by 0.04 to get 10.4. Do the same to 270.4 to get 281.22. I'd only have to assume you don't get interest off of interest, so it'd round down to 280.
The formula is
A=p (1+rt)
A future value?
P present value 250
R interest rate 0.04
T time 3years
A=250×(1+0.04×3)
A=280

Hope it helps!

what is 63 as the product of prime factors in ascending order?

Answers

When we arrange the numbers in such an order that it starts from the smallest number and goes towards the largest number, that order is called ascending order.
Prime factors of 63 are : 3, 3, 7
As 3 repeats and 3 is smaller than 7 so, when we write this in ascending order as the product of these, we write in such a way;
63 = 3 x 3 x 7 = 3² x 7
Now 3² = 9 and 9 is greater than 7,so,
63 = 7 x 9

(y3 - 4y2 + 7y - 6) ÷ (y - 2)

Answers

(3y-8y+7y-6)/(y-2)
(2y-6)/(y-2)
2(y-3)/2(y/2-2)
(y-3)/(y/2-2)

What is an equation of the line in slope-intercept form? m = 2 and the y-intercept is (0, 3)

Answers

set up as y=mx+b
y=2x+3
Straight line equation is given in the form

y = mx + c

m represents the gradient and c represent where the line intercept y-axis

The y-intercept happens when the value of x-coordinate is 0, so the coordinate is (0, c)

We have, m = 2 and c = 3
The equation of the line is: y = 2x + 3

When four basketball players are about to have a​ free-throw competition, they often draw names out of a hat to randomly select the order in which they shoot. What is the probability that they shoot free throws in alphabetical​ order? Assume each player has a different name.

​P(shoot free throws in alphabetical ​order) = _____

Answers

The total number of possibilities of drawing their names is given by permutation.

4P4 = 24

 

The total possibility of drawing their names in alphabetical is only 1.

 

Therefore the probability is:

P = 1 / 24

P = 0.0417

 

Therefore there is about 4.17% chance that it will be in alphabetical order

A vertical plane intersects the three-dimensional object in the image and divides the object into equal halves. What is the shape of the cross section?

Thank you :)

Answers

If you were to take a knife and cut this shape down the middle, starting from the top, what will the cross section look like? 
It will look a lot like how the object looks from the side.
The best answer is D, the last image. 

Answer:

Option 4 is correct .

Step-by-step explanation:

Given : A three dimensional figure

To Find : What is the shape of the cross section?

Solution :

If we intersects the three-dimensional object in the image and divides the object into equal halves by vertical plane then we can see the attached figure what the output will be .

We can see that if we see the cross section from the side then it looks like the fourth one

So, Option 4 is correct .



David bought a used car for $3,000 and later sold it for $1,000. What was the approximate percent decrease in the price of the car?

Answers

The approximate decrease is around 66 percent.
The approximate percent decrease in the price of the car, would be 66%. Hope this helps.

Lets find F^(-1) if
y=-2x+1
I’m not sure if the F^(-1)=1+x/2

Answers

close enough, let's do the switcharoo of the variables and solve for "y".

[tex]\bf y=-2x+1\qquad \boxed{x}=-2\boxed{y}+1\implies x-1=-2y \\\\\\ \cfrac{x-1}{-2}=y\implies \cfrac{1-x}{2}=\stackrel{f^{-1}}{y}[/tex]
So, again, we have our rules for mapping [tex]y[/tex] to [tex]x[/tex]:

[tex]y=-2x+1[/tex]

To find [tex]f^{-1}[/tex], we solve for [tex]x[/tex].

[tex]y-1=(-2x+1)-1[/tex] (subtract 1 from both sides)
[tex](y-1)/(-2)=(-2x)/(-2)[/tex] (divide both sides by -2)

That gives us

[tex]x= \frac{y-1}{-2} [/tex]

Now that we have a way of mapping [tex]y[/tex] back to [tex]x[/tex], all we do is swap the domain and range, and we have

[tex]f^{-1}(x)= \frac{x-1}{-2} [/tex]

for the function:

f(x) = -3x^4

complete the table of values using at least 5 points.


x -2 -1 0 1 2

f(x)

Answers

To find the value of f(x) at the 5 provided values of x, we substitute that particular value for x in [tex]-3x^4[/tex].

Doing so, we get:

[tex]f(-2)=-3(-2)^4=-3(16)=-48\\ f(-1)=-3(-1)^4=-3(1)=-3\\ f(0)=-3(0)^4=0\\ f(1)=-3(1)^4=-3(1)=-3\\ f(2)=3(2)^4=-3(16)=-48[/tex]

Marla has a pet hamster. The hamster makes 3 laps around her cage every minute.

What line represents the situation?

Line a

Line b

Line c

Line d

Answers

Find the line that goes up three for every one to the right it goes. B is the line that fits the equation.

Let

x-------> the time in minutes

y------> the number of laps

we know that

In this problem the linear equation represent a direct variation and the slope is equal to

[tex]m=3\frac{laps}{minute}[/tex]

so

the equation of the line is

[tex]y=3x[/tex]

For [tex]x=1\ minute[/tex]

the value of y is equal to

[tex]y=3*1=3\ laps[/tex]

Plot the point [tex](1,3)[/tex] in the graph

therefore

the answer is

The solution is the line b

see the attached figure to better understand the problem

Y -2 > -11 what is the answer to this

Answers

-9 because you add positive 2 to counter act -2 which gives you -9
14???????????????????????

C(x) = 0.5x+70 find the domain and range

Answers

This function is defined from -inf to inf for all real numbers of x. The only reason a function would have a break in the domain and range would be if there was a radical, fraction, ln, etc(any operand that has a restriction)

The formula for the area of a triangle is a=1/2bh. solve the formula for h. a triangle has a base of 7cm and an area of 28cm squared. what us it's height

Answers

28=1/2(7)h
Divide by 7 on both sides giving you
4=1/2h
Multiply by 2 on both sides giving you
h=8
Therefore, the height is 8cm.

Answer: 8 cm

Step-by-step explanation:

Given : The formula for the area of a triangle is [tex]a=\dfrac{1}{2}bh[/tex]

If a triangle has a base of 7 cm and an area of 28 cm squared.

The substitute the values of b = 7 and a = 28 in the above formula, we get

[tex]28=\dfrac{1}{2}(7)h[/tex]

Divide 7 and multiply 2 on on both sides, we get

[tex]h=\dfrac{28\times2}{7}=4\times2=8\ cm[/tex]

Hence, the height of triangle = 8 cm

Write 3 ½% as a fraction

Answers

Answer:

  7/200

Step-by-step explanation:

3.5% = 3.5/100 = (3.5/100)×(2/2) = 7/200

_____

The % symbol is a shorthand way to write "/100", so 3.5% = 3.5/100.

Other Questions
10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Steam Workshop Downloader