What occurs when a muscle becomes weaker and smaller from not being used?
Answer

gets stronger

atrophy

weight gain

turns to fat
...?

Answers

Answer 1
The best and most correct answer among the choices provided by your question is the third choice.

Atrophy occurs when a muscle becomes weaker and smaller from not being used

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
Answer 2
the answer is weight gain hope this helps

Related Questions

What is one evolutionary advantage angiosperms have over gymnosperms?

Answers

 Angiosperms contain both seeds and flowers, while gymnosperms only contain seeds. 

Answer: The one evolutionary advantage of angiosperm over gymnosperm is the pressence of flowers. The pressence of flower makes it most successful among other plant group. The pressence of flower in the plant makes plant look more attractive and attracts insects for pollination. This property allows better transportation of flower.The more the insects are attracted towards the plant the transportation of seed will be more.





Explain why some substances are able to pass through the cell membrane

Answers

The most important property of the cell membrane is its selective permeability: some substances can pass through it freely, but others cannot. Small and nonpolar (hydrophobic) molecules can freely pass through the membrane, but charged ions and large molecules such as proteins and sugars are barred passage. 
selective permanently, is the reason why the cell membrane only let's certain things pass through. small noon polar molecules (oxygen & carbon dioxide) pass through by simply diffusing. But other molecules use other types of passive transport or active transport.

What is the first 25 cm of the small intestine called?

Answers

its called the duodenum.

hope this helps you

When walking through the woods Adam and Alise saw many mushroom-like organisms growing out of logs that were laying on the ground. These logs were pieces of trees that had either completely fallen down or had broken off of the larger tree. What did Adam and Alise really see?

A. The mushrooms were only anchored to the dead logs and were undergoing photosynthesis.
B. The mushrooms were helping the trees to stay alive.
C. The mushrooms were decomposing the dead tree logs.
D. The mushrooms and tree logs were exchanging genetic material.

Answers

Your answer is C. the mushrooms were decomposing the dead tree logs :)

Answer: Option C

Explanation:

The mushrooms belongs to the family of fungus. These are natural decomposers that helps in cleaning of the environment. They feed on the dead and decaying organic matter.

Feeding on the dead and decaying organic matter provides food to mushroom and helps in decomposing the matter and adding nutrients back into the soil.

hence, Adam and Alise saw that mushrooms were decomposing the tree log.

Which of the following best defines soil texture? A A measure of how developed a soil is B Amount of nutrients in the soil C Depth of the soil D The relative amounts of sand, silt and clay particles

Answers

Correct answer is D "the relative amounts of sand, silt, and clay particles"

How many calories are in carne asada nachos from Albertos?

Answers

935 thats too much for me, i cant take it

Denise heats a beaker of dilute acid on a hot plate in a fume hood. What should Denise wear to best protect herself when she transports the beaker to a balance outside the hood?
A. heat-proof gloves, a lab coat, and close-toed shoes
B. goggles, a lab coat, and close-toed shoes
C. goggles, a lab coat, and heat-proof gloves
D. goggles, a lab coat, heat-proof gloves, and close-toed shoes

Answers

The correct answer is D. goggles, a lab coat, heat-proof gloves, and close-toed shoes

This will protect her from everything since the fumes could enter her eyes, or they could spill on her hands, body, or feet, so all of this protection is necessary if it is an acid. 

Answer: Option (D) is the correct answer.

Explanation:

Working in a laboratory can be dangerous if proper precautions are not followed.

Since, Denise heats a beaker of dilute acid on a hot plate in a fume hood so, he should be wearing goggles, a lab coat, heat-proof gloves, and close-toed shoes.

This is because even if accidentally acid spurts or falls on his feet then his skin must be covered so that he doesn't get burned.

which of the following statements about colonial organisms is correct

Answers

Their cell activities are integrated
I Believe the Answer is (B)

what are the special properties of water

Answers

Boiling Point and Freezing Point
Surface Tension
Heat of Vaporization and Vapor Pressure
Viscosity and Cohesion
Solid State
Liquid State
Gas State

which gland in the endocrine system is involved in dwarfism?

Answers

Answer: Pituitary Gland

Explanation:

Pituitary dwarfism or the growth hormone deficiency is the condition in which the pituitary gland of the body does not makes enough hormone.

This results in a slow growth in the child and it results in small stature. The height of the child does not increases and and other growth related characters are also not found at the right time.

This is so because the growth hormones are not released from the pituitary gland.

20 POINTS!!! MORE THAN ONE ANSWER!!!!

Why are invasive species considered a threat to native wildlife?

They can breed and spread quickly.
They consume native species’ food supply.
They evolve, and native species don’t.
They all have higher genetic diversity than native species.
They don’t need resources from the environment as native species do.

Answers

They can breed and spread quickly.

They consume native species’ food supply.

They can breed and spread quickly.

They consume native species’ food supply.

Invasive species disrupt the ecosystem.

What are invasive species?Invasive species, also called introduced species, alien species, or exotic species, any nonnative species that significantly modifies or disrupts the ecosystems it colonizes. Such species may arrive in new areas through natural migration, but they are often introduced by the activities of other species.

To know more about species here

https://brainly.com/question/13259455

#SPJ3

The products of photosynthesis are the

Answers

Oxygen and sugar in glucose form.
When a plant takes in H20 (water) and rays from the sun, it also takes in CO2 (carbon dioxide), and it compounds the molecules and it produces Glucose( a type of sugar used for energy) and Oxygen

An organic compound that contains carbon, hydrogen, and oxygen is most likely

Answers

It is likely a carbohydrate

One active transport process that occurs in the electron transport process in the membrane of the _____________ is the transport of protons to produce a proton gradient to power the production of ATP.

Answers

...membrane of the CELL...

the answer is B, it is mitochondria

The cells in your body need nutrients and other materials to stay alive. To be used by your cells, the materials must be
a. slightly acidic
b. eukaryotic
c. dissolved in fluid
d. transgenic

Answers

b. eukaryotic is the answer. 

The cells in your body need nutrients and other materials to stay alive. To be used by your cells, the materials must be dissolved in fluid. The correct option is c.

What is a cell?

Cells are the fundamental building blocks of all life. Various of cells make up the human body. They give the body structure, absorb nutrients from food, and convert those nutrients into energy.

The cell, first discovered by Robert Hooke in 1665, has a rich and interesting history that has led to many of today's scientific advances.

Cells, as we've seen, require a constant supply of energy to generate and maintain the biological order that keeps them alive.

This energy is derived from the chemical bond energy in food molecules, which serve as fuel as a result.

To survive, cells in the body require nutrients and other materials. The materials must be dissolved in fluid before they can be used by cells.

Thus, the correct option is c.

For more details regarding cell, visit:

https://brainly.com/question/3142913

#SPJ6

What if we lived on jupiter?

Answers

It would be difficult but not impossible. The gas giant has a small rocky core with a mass of 10 times less than earth's but it is surrounded by dense liquid hydrogen to 90% of Jupiter's diameter.

Which of the following outcomes would be most likely if the membrane of a cell were no longer selectively permeable?

A)A cell wall would form outside the membrane to protect the contents of the cell.

B) Harmful substances would be able to enter the cell and cause mutations to the cell’s DNA.

C) The cell would die as it would not be able to regulate which substances could enter and leave.

D) The cell would grow as more nutrients would be able to easily enter the cell. ...?

Answers

The correct answer is:

The cell would die as it would not be able to regulate which substances could enter and leave.

:)


The most likely outcome if a cell membrane lost its selective permeability would be the death of the cell, as it would be unable to maintain homeostasis and regulate substance movement, leading to harmful consequences.

The correct option is 'C'.

If the membrane of a cell were no longer selectively permeable, the most likely outcome would be C) The cell would die as it would not be able to regulate which substances could enter and leave.

The plasma membrane's primary function is to maintain selective permeability, which is crucial for sustaining life within the cell.

Losing this ability would lead to an inability to maintain homeostasis, an essential stable internal environment. Without a selectively permeable membrane, harmful substances could enter the cell, essential nutrients could be lost, waste products could accumulate, and even the movement of water could cause the cell to swell and burst.

Which describes a constant in an experiment?


A.

the variable changed by the experimenter




B.
the quantity that must remain the same




C.
the variable that changes in response to the experiment




D.
the statement that is worded to test the experiment

Answers

A constant in an experiment is B. the quantity that must remain the same. If it is constant, it doesn't change, so it cannot be variable. D makes no sense.

what is an alternative future for cells when they reach their size limit? ...?

Answers

An alternative future for cells when they reach their size limit are:

1. Divide, forming two smaller daughter cells. 
2. Become large by dint of becoming multinucleated, and flattening (slime mold) or becoming a "tube" (fungi) to maintain surface area to volume ratio. 

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!

A population of sixteen emu grew to thirty-nine in one year. After two years, the population had grown to forty-eight. The maximum number of emu that the environment can support is approximately sixty due to limited resources such as food and water. The carrying capacity of the emu population is

Answers

The answer is sixty.

A carrying capacity is the maximum size of some population in the given environment. It represents the number of animals that can live, reproduce, survive in the given area regarding the indefinite sustainability of this area in terms of resources. If the maximum number of emu that the environment can support is approximately sixty, then the carrying capacity must be 60 as well

Answer:

60

Explanation:

"The maximum number of emu that the environment can support is approximately sixty due to limited resources such as food and water."

In a population of gerbils, long hair (H) is completely dominant over short hair (h). If 18% of the population has short hair, calculate the percentage of the population that is expected to be heterozygous (Hh). ...?

Answers

Below are the choices that can be found elsewhere:

A) 29% 
B) 58% 
C) 80% 
D) 49%

q^2 + 2pq + p^2=1 


And q + p = 1 

You have q^2 which is 0.18, which stands for the homozygous recessive. p^2 is homozygous dominant percentage while 2pq is what you're looking for, heterozygous. 

Anyway to find your answer, square root q^2 to find q, then you can use q+p=1 to find p. Then use 2pq to find the percent of heterozygotes. The answer for your question is D.

Answer:

49 percent

Explanation:

I got this question correct on the quiz.

How does carbon in sediments reach the atmosphere

Answers

decomposition, fossil fuel formation, fossil fuel emmision

Arrange the celestial bodies in our solar system in increasing order based on their size.

Answers

Sun,Jupiter,Saturn,Uranus,Neptune,Earth,Venus,Mars.
These are just the planets. There are much much more if you include moons too.

Sun, Jupiter, Saturn, Uranus, Neptune, Earth, Venus, and Mars.

What is celestial bodies?

A glowing plasma spheroid that is held together by its own gravity is the basic building block of a star, a type of astronomical object. The Sun is the star that is closest to Earth.

Due to their immense distance from the Earth, many additional stars are visible to the unaided eye from the surface of the planet at night while gazing at a variety of fixed luminous locations in the sky. The brightest stars received formal labels, and historically, the most visible stars were organized into constellations and asterisms.

Star catalogues that list known stars and provide standardized stellar designations have been assembled by astronomers. However, the number of stars in the universe is estimated to be over 300 sextillions (3 1023), including all-stars outside of our galaxy (the Milky Way).

Therefore, Sun, Jupiter, Saturn, Uranus, Neptune, Earth, Venus, and Mars.

To learn more about celestial bodies, refer to the link:

https://brainly.com/question/28876984

#SPJ5

A marine biologist was taking photographs of ocean animals. One animal had tentacles with long stinging cells on the end. Which of these groups did the animal belong to?

A.
mollusks

B.
cnidarians

C.
arthropods

D.
sponges

Answers

cnidarians

hope this helps :)

Final answer:

The animal observed by the marine biologist, characterized by tentacles with long stinging cells, belongs to the group of (option B.) cnidarians. This group, which includes jellyfish, corals, and sea anemones, uses cnidocytes with nematocysts to immobilize prey.

Explanation:

A marine biologist observed an animal with tentacles possessing long stinging cells at the end, indicating that the animal belongs to the group cnidarians. Cnidarians, a phylum that includes organisms like jellyfish, corals, and sea anemones, are known for their unique cells called cnidocytes, which contain nematocysts (stingers). These specialized cells are designed to immobilize prey with toxins, allowing cnidarians to catch their food effectively. The presence of tentacles with stinging cells is a distinctive feature of cnidarians, distinguishing them from other groups such as mollusks, arthropods, and sponges.

Which claim below accurately explains how the process of meiosis results in genetic variation?

Answers

Below are the options:

Having two phases of meiosis allow for more unique cells to be produced.


Meiosis is a form of asexual reproduction which leads to more genetic variation.


Meiosis produces 4 haploid daughter cells which all contain identical DNA segments.


Crossing over during metaphase allows segments of DNA from 2 parents to SWAP and produce non-identical haploid cells.

The answer Meiosis is a form of asexual reproduction which leads to more genetic variation

Genetic Engineering in Bacteria. Human DNA is spliced into the _______, which is a small ring of DNA in bacteria. The _________ takes up the plasmid. It now contains the human gene. The bacterial cell reproduces the _____________ that the human gene codes for.

Answers

Here are the answers that would best complete the given statements above. Genetic Engineering in Bacteria. Human DNA is spliced into the PLASMID , which is a small ring of DNA in bacteria. The BACTERIAL CELL takes up the plasmid. It now contains the human gene. The bacterial cell reproduces the PROTEIN that the human gene codes for. Hope this answer helps.

Which is not true of lipids?

Answers

Where's the optionsssssssss

Answer:

Explanation:

They form structural parts of cell membranes.

 

The carry fat-soluble vitamins to cells.

 

They supply cells with energy.

 

They supply cells with nitrogen.

Compare the chromosomes in the two daughter cells produced by Meiosis I. Do these chromosomes have the same alleles? How do you know?

Answers

yes. daughter cells have to match

How does oxygen production relate to the rate of photosynthesis?

Answers

In the process of photosynthesis, plants use water (H₂O) and carbon dioxide (CO₂) to produce glucose (C₆H₁₂O₆) and oxygen (O₂) is released as a waste product:

H₂O + CO₂ → C₆H₁₂O₆ + O₂

So, more photosynthesis means more oxygen. In other words, the higher the rate of photosynthesis is, the higher is oxygen production.

Photosynthesis produces the glucose that is utilized in cellular respiration to make ATP. The glucose is then transformed back into carbon dioxide, which is used in photosynthesis. While water is split down to form oxygen through photosynthesis, in cellular respiration oxygen is mixed with hydrogen to form water.The oxygen production compares to the rate of photosynthesis because there is a greater flow of oxygen when it narrates to photosynthesis at a great rate.

The overall reaction is described as follows.

H₂O + CO₂ → C₆H₁₂O₆ + O₂


What are the parts animal cell?

Answers

the cell membrane, nucleus, nucleolus, vacuole,lysosome, cytoplasm, mitochondrion, endoplasmic reticulum, golgi complex are the main parts of an animal cell
Other Questions
Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Steam Workshop Downloader