which is an example of an economic factor that affects the business environment ?

Answers

Answer 1
Here are a couple of things hope they help

1.)  Interest rates
2.) Taxes Inflation
3.) Currency
4.) exchange rates
5.) Consumer discretionary income
6.) Savings rates
7.) Consumer confidence levels
8.) Unemployment rate
9.) Recession
10.) Depression

Answer 2
Final answer:

Good weather is an example of a natural condition that can affect the supply of agricultural goods by improving crop yields, which in turn impacts the business environment.

Explanation:

An example of an economic factor that affects the business environment is changes in weather or climate conditions. These changes can significantly influence the cost of production, particularly for agricultural products. For instance, good weather can improve crop yields, thus increasing the supply of agricultural goods in the market. Conversely, poor weather, such as droughts or floods, can decrease supply, leading to higher market prices. Businesses need to consider these fluctuations when planning their production cycles and pricing strategies.

Other factors that also affect supply include changes in the prices of inputs, advancements in production technology, and certain government policies that can either facilitate or hinder production processes, thus impacting the business environment.


Related Questions

Mark's gross pay for the week was $950.00. his total deductions were $118.54. what is his net pay?
a. $832.54
b. $831.46
c. $831.54
d. $832.46

Answers

the answer is B.. 950-118.54 =831.46

Answer:

b. $831.46

Explanation:

Gross salary is the combined amount in the employment contract, which is considered without deductions. The net salary is the amount the worker actually receives, that is, the amount of gross salary less deductions.

Deductions were $ 118.54 and gross salary was $ 950.00.

So just make the decrease account:

$ 950.00 - $ 118.54 =  $ 831.46

____ readers provide a way to find out what others are saying about an entrepreneur's company by enabling the entrepreneur to subscribe to blogs and podcasts.​

Answers

Rss readers allow you to subscribe to content

For a report to focus on the needs of typical business readers today, it needs to be trustworthy, contain decision-related information, and:

A. put the summary at the end of the discussion.
B. use complicated language to impress the readers.
C. require a password to open the report document.
D. make it easy for readers to get the point quickly.

Answers

Answer:

D. make it easy for readers to get the point quickly.

Explanation:

For a report to meet the needs of business readers, it must be reliable, contain relevant information, and make it easier for readers to quickly understand the information they want to convey. This can be accomplished through simple but punctual language. That's because the reports need to be clear so readers can make their decisions.

D. The report needs to be trustworthy, contain decision-related information, and make it easy for readers to get the point quickly.

Business executives are often busy and under pressure to make quick decisions with incomplete data. They value concise, well-organized reports that allow them to quickly grasp the key points, insights, and recommendations. Using complicated language to impress readers or requiring a password can create unnecessary barriers.

Therefore, it is crucial to present the report in a clear and accessible manner, enabling the readers to understand the information efficiently.

In 1 or 2 sentences, describe why compound interest earns more money than simple interest.

Answers

Simple interest is set in place by an interest rate that is multiplied by the total amount of money you have in place. While compound interest is essentially interest on top of your simple interest. It accumulates over time making you more money.

What does “monetary policy” mean?

A. Federal Reserve policies on creating new banks

B. political policies pursued by the federal government

C. actions the Federal Reserve takes to influence the economy

D. decisions about how much the Federal Reserve charges members

Answers

The answer is "C. actions the Federal Reserve takes to influence the economy".


Monetary policy is the way central banks oversee liquidity to make monetary development. Liquidity is how much there is in the cash supply. That incorporates credit, money, checks, and currency showcase shared assets.  

Preferably, monetary policy should work deliver glove with the national government's financial approach. It once in a while works along these lines. Government pioneers get re-chose for lessening charges or expanding spending.

Final answer:

Monetary policy refers to the strategies and actions undertaken by the Federal Reserve to influence the economy. It includes changes to interest rates, buying/selling of government securities, and controls on the reserve requirement.

Explanation:

Monetary policy, represented by choice C in your question, refers to the actions the Federal Reserve (or a country's central bank) employs to influence the state of the economy. These actions might involve changes made to interest rates, the buying and selling of government securities, or alterations to the amount of money banks are required to keep in reserve. Such measures aid in controlling inflation, managing employment levels, and ensuring economic stability.

This is not about creating new banks (option A) or about what the Federal Reserve charges its member banks (option D). Also, while monetary policy has political implications, it is distinctly separate from political policies pursued by the federal government (option B).

Learn more about Monetary Policy here:

https://brainly.com/question/34209846

#SPJ6


Where might you gain insights to what is important within content you are about to read?



a.

Chapter questions

c.

Index


b.

Table of contents

d.

Glossary






Please select the best answer from the choices provided




A

B

C

D

Answers

The correct option is CHAPTER QUESTIONS.
When you are about to read a particular chapter in a book and you now go ahead to read the questions that are attached to the chapter first. This will give you an excellent idea of the information you are going to read in the chapter and it will make you to be sensitive to the important information in the chapter. Unconsciously, you will also find yourself reading carefully in order to locate the answers to the questions you have read.

Answer:

A

Explanation:

Where might you gain insights to what is important within content you are about to read?

Chapter Questions will actually give an oversight into themes and issues raised in the chapter. They are very useful to point to the reader the summary of ideas raised within the chapter.

Glossary are used to document terms and meanings used within in a book

index gives page numbers of words

Table of contents: Puts chapters into section and subsection. It makes the reader have an overview of the content of document.

So A is correct  

If you worked as an employee, where can you find the information about how much money your employer withheld for federal income tax?


A. In your bank account statement


B. On your W-2 form


C. On the IRS Web site


D. On your 1040EZ form

Answers

b. on your w-2 form
I think

Apples are part of which factor of production?
a. land
b. labor
c. capital
d. scarcity user: which of the following is not a factor of production?
a. land
b. labor
c. capital
d. pollution

Answers

Answer:

a. land

d. pollution

Explanation:

Production factors is an economic term used to describe the elements that are essential for all productive sectors in a country. In short, it is around these factors that the entire production chain of a company, or an organization, is established.

These factors are: land, capital and labor.

The land is home to factors related to natural resources such as plants, fruits, soil, water, vegetables, among others. Capital refers to the resources related to producing goods and services, such as money, cars, machinery, equipment, among others. Finally, the work refers to human labor, which will make the entire production process working.

Costa Rica is a top exporter of coffee. The highest quality coffee is sold abroad, and the lower quality coffee is consumed by native Costa Ricans.

Which of the following statements best describes the economic questions this paragraph addresses?

For whom to produce? and What to produce?

For whom to produce? and When to produce?

How to produce? and For whom to produce?

What to produce? and How to produce?

Answers

The best and most correct answer among the choices provided by the question is the first choice or letter A.

The questions "For whom to produce? and What to produce?"  best describes the economic questions the paragraph addresses.


I hope my answers has come to your help. God bless and have a nice day ahead!

The correct answer would be A. It answers the questions "For whom to produce? and What to produce?"

What amount is a reasonable tip for an airport skycap?

Answers

At least $2 per bag as most airlines don't pay.

Answer:

$ 2 tip for luggage.

Explanation:

As in many situations of our life, travel usually works wherever you go do what you see, for example, when leaving tips. If you do not want to look bad in the restaurants or taxis of your destination or if you are one of those who take control of your travel expenses, keep in mind that there are countries in which it is highly recommended to leave a tip and others in which It is mandatory. The main reason is that this amount is important to complete the waiter's salary. However, and even if you don't believe it, there are destinations in which not only do they not usually tip, but it is frowned upon to do so.

In general, for airport skycap you pay $ 2 tip for luggage.

Jim is considering going back to school for an additional degree if the job market is bad. Which of the following actions is consistent with Jim's plan?

The economy is in a recession, so Jim goes back to school.

The economy is expanding, so Jim goes back to school.

The economy is contracting, so Jim does not go back to school.

The economy is booming, so Jim goes back to school.

Answers

Your best answer is A.The economy is in recession, so Jim goes back to school. This is the most logical answer because, if the economy is expanding, contracting, or booming Jim would have no need to return to school for an additional Degree. Hope this helps.

what is the first action you should take if you suspect there has been a fraudulent charge on your credit card?

Answers

Contact your bank or card provider. Hope this helps! :)

Contact the credit card company is the first action we should take if we suspect there has been a fraudulent charge on the credit card.

Further explanation:

Credit card:

Credit card is issued by financial institutes such as banks. A credit card is a plastic card that allows the cardholders to borrow the funds from the respective bank and spend the funds as per their requirements. A credit card can be used for the purchase of goods and services. A credit card has a specific limit. It is known as a line of credit (LOC). The cardholder can withdraw or use the funds up to the LOC. The cardholder has to pay the borrowed amount along with interest on the borrowed funds after a specific period of time, which is defined and stated at the time of issuing the credit card.

Steps to be taken if a fraudulent charge on the credit card happened:

The first step is to inform the credit card company regarding the fraudulent issue. Change the password or pin of the credit card. Inform the company and call the police of the region. Check the statements of the credit card. Check the online shopping details. Maintain the balance and keep an eye on the amount of the credit card bills and statements.

Thus, the first step is to inform the credit card company regarding the fraudulent charge onthe credit card.

Learn more:

1. Common credit card fee

brainly.com/question/1124275

2. Charging fee in case of credit card

brainly.com/question/2668305

3. Consequences of non-payment of monthly credit card payment

brainly.com/question/3211811

Answer details:

Grade: High School

Subject: Business studies

Chapter: Money and banking

Keywords:What is the first action you should take if you suspect there has been a fraudulent charge on your credit card, statements, cards, online shopping, credit card bills, shopping, credit card company, password, pin, keep an eye, police, region.

Jan pays $70 each month for her auto insurance policy.This regular payment is called a

Answers

this type of regular payment is called a : premium

Premium refer to the payment that a person make upfront in order to receive a service. According to the company's policy, Jan's insurance could be instantly deactivated as soon as she stopped paying the premium

Owners of the teams in the nfl started the league as a way to make money by providing entertainment to their audiences. what type of result happens when the nfl team owners make a lot of money?
a. latent function
b. manifest function
c. social deconstruction
d. social dysfunction

Answers

The answer should be a, i think i do know this but im not sure. sorry. D:


Holton is the manager at a small restaurant. What can he do to ensure the workplace offers a safe environment for employees?

Answers

Answer and explanation:

When managing a restaurant it is important to keep certain safety guidelines to ensure the employees' well-being. Installing smoke detectors, making sure the cooking area is clean and out of plagues, giving employees special uniforms to ensure hygiene and prevent burns, and keeping a first-aid kit in front of mild emergencies are some practices managers should promote.

A landscaping company has just bought $1,000 worth of pesticide for its employees to use on the properties it services. However, the company just received a letter saying that it now needs to spend hundreds of dollars for protective equipment for its employees to wear when applying the pesticide. What agency is most likely responsible for this requirement?
Answer Choices:
a)Environmental Protection Agency
b)Federal Communications Commission
c)Federal Trade Commission
d)Food and Drug Administration
e)Transportation Security Agency

Answers

a/Environmental Protection Agency

Answer:

The correct answer is A: Environmental Protection Agency.

Explanation:

The United States Environmental Protection Agency is the name given to an indenpendant agency in the country whose main purpose is to take care of the correct and proper protection of the health of the people in subjects related to the environment, including avoiding pollution and educating to the people about it. It was created in 1970 by the President Richard Nixon and since then has been regulated by statutes authorized by Congress.

Which two types of taxes provide the largest amount of revenue to states?

Answers

sales taxes and individual income taxes
Economics, Unit 6, Lesson 10: Unit Assessment: Government and the Economy

1. D - Medicare provides health care for people over 65, and Medicaid offers benefits for low-income families and individuals.

2. C - mandatory spending programs

3. A - sales tax and individual income taxes

4. B - The federal Reserve coordinates all regulatory activities and examines banks periodically.

5. D - As interest rates rise, people generally keep their wealth in assets that pay returns, restricting the money supply.

6. A - a cash deposit into the banking system on the money supply.

7. C - It would force banks to recall a significant number of loans, which would hurt many borrowers.

8. D - benefits to older citizens, surviving family members of wage earners, and people with certain disabilities

9. C - So that the government can pay bills as they come due

10. D - An operating budget is for day-to-day expenses; a capital budget is for investment spending.

11. A - a social welfare program providing benefits to people who meet certain eligibility requirements

12. C - regressive tax.

13. A - The tax represents a larger proportion of Josh's income.

14. D - Your employer sends it to the federal government to help pay your income tax bill,

15. D - the convenience store on the corner

16. D - all of the above

17. B - by Congress and the White House.

18. A - there is a budget surplus.

19. A - loan money to the government.

20. B - most states require a balanced budget for state spending.

21. D - to lessen the effect of natural business cycles

22. D - to provide consumers with access to funds for business expansion

23. C - 12

24. D - The economy is expanding quickly and inflation is a concern.

25. A - As interest rates decrease, demand for money increases.

26. The money the government spends creates jobs which in turn could create a chain reaction in the economy.

27. A good tax should have simplicity, efficiency, certainty, and equity. By simplicity, we mean tax laws should be easily understood. By efficiency, we mean government administrators should be able to collect taxes without spending too much time or money. By certainty, we mean it should be clear to the taxpayer when a tax is due, how much money is due, and how the tax should be paid. By equity, we mean the tax system should be fair; no one should bear too much or too little of the tax burden.

Which of the following would be the main reason you use the task feature?
A) To be able to find your contacts quickly.
B) To help organize our emails
C) To help manage your time effectively
D) To help manage your contacts

Answers

To help manage your time effectively which would be the main reason you use the task feature. The correct option is C.

What is the purpose of the learning task?

Learning tasks should build on previous activities rather than being repetitive, and they should allow students to engage with and develop their skills, knowledge, and understanding in a variety of ways. Meaningful activities involve students in ways that are active, constructive, intentional, authentic, and cooperative.

Task management software allows you to consolidate all of your activities in one location, eliminating the need for multiple passwords and accounts. It eliminates the risk of information being deleted or lost, which can greatly improve the efficiency of the work your team does on a daily basis.

Thus, the ideal selection is option C.

Learn more about the task feature here:

https://brainly.com/question/26528398

#SPJ3

A truck belonging to office furnishing failed to yield the right of way at an on ramp and crashed into an automobile. Damages included 1,800.00 to the truck and 4,000.00 to the car. In addition, the drivers of the crash was granted 56,000.00 of internal injuries from the collision. Office finishing carries 50/100/10 liability, comprehensive and 250.00- deductible collision insurance. How much of the total expenses is office furnishing responsible for?

Answers

Answer:

$250

Explanation:

A 50/100/10 insurance policy means that the policy will cover a maximum of $50,000 for individual injuries, $100,000 as maximum liability for total personal injuries and $10,000 for property damage.

Property damages = $1,800 + $4,000 = $5,800 (fully covered by the policy, max. $10,000).

The drivers, meaning more than 1, therefore we assume that $56,000 was used to cover total personal injuries (fully covered by the policy, max. $100,000).

Therefore, office furnishing must only pay the $250 deductible, since the policy covers the rest of the expenses.

The theme of a birthday party should always be based on a. the interests of the person throwing the party. b. the current trends in birthday parties. c. whatever appeals to the client at the time. d. the interests of the guest of honor.

Answers

The theme of a birthday party should always be based on (D. the interests of the guest of honor. 

Why did manufacturers hire children to work in their factories?

Answers

For cheaper labour, which therefore increases profit.

Many people are surprised that working for a charitable organization can be as good for your career as working for a:

A. Lemonade stand.
B. Parent.
C. Fortune 500 company.
D. Child.

Answers

i believe the answer is A becuase working at a lemonade stand helps you kinda run a business if you think about it

Working for a charitable organization can be as beneficial to one's career as working for a Fortune 500 company due to the valuable skills and experiences gained. Effective Altruism endorses maximizing impact through strategic career choices, like earning to give, rather than direct volunteering.

Many people are surprised to learn that working for a charitable organization can be as good for your career as working for a Fortune 500 company. This may in part be due to the vast array of skills and experiences one can gain in the nonprofit sector, which can be highly valued in the corporate world as well.

Furthermore, in today's career landscape, having a diverse range of experiences, including those gained from working with nonprofits, can enhance an individual’s resume as it shows a commitment to social responsibility and provides a broad perspective. Career development is not just about the prestige of a company, but also about the learning opportunities and contributions to society that can arise from different types of work.

An argument presented by Effective Altruists suggests that if we aim to maximize the good we do, prioritizing earning to give—such as working overtime and donating to highly efficient charities like those recommended by Effective Altruist organizations—can be more impactful than direct volunteering, like working in a soup kitchen.

Which of these is the best example of an asset?
A. the electricity in a home
B. the shirt someone is wearing
C. the coffee someone drank this morning
D. an old, used airline ticket

Answers

The example of an asset is the shirt someone is wearing. An asset is something that an owner has. A shirt is an asset because it's a thing that an owner has and he can sell it in the future. He can benefit from this when he makes a profit out of it. An asset means an ownership that a person has just like land, house, car, and all properties.
Final answer:

The best example of an asset is the electricity in a home.

Explanation:

The best example of an asset out of the given options is A. the electricity in a home.

An asset is a resource with economic value that an individual or organization owns or controls with the expectation that it will provide future benefits.

The electricity in a home is considered an asset because it has economic value, is owned or controlled by the homeowner, and provides a significant benefit by powering appliances, lights, and other electrical devices.

Learn more about asset here:

https://brainly.com/question/33117914

#SPJ6

Of the following statements, which one or ones indicate possible effects of a low credit score? I. You will have a difficult time qualifying for loans. II. Any loans you take out will be relatively short-term. III. You will have to pay higher than average interest rates. a. I only b. I and II c. III only d. I and III

Answers

When you have a low credit score there are many things that can effect your loan agreements. Typically you will have a difficult time qualifying for loans. Due to your low credit score, it shows that you have issues paying for the items you have which makes it hard for other lenders to want to give you loans because they could lose out. You also normally pay higher than average interest rates. When you have bad credit and do not pay items back properly lenders who do approve you for a loan will often provide you with a high interest rate because they are afraid they may lose big time if you stop paying. You are a risk for lenders to go ahead with the loan so they try to cover themselves in the event it happens.

Answer: D. I and III

Answer:

Answer: D. I and III

Explanation:

You go to the bank to trade a dirty dollar for a new, clean one. The cashier tells you the trade is not necessary because currency is

divisible

scarce

portable

stable in value

Answers

Answer:

D) stable in value

Explanation:

money still exists and used, either dirty or clean dollar bills

Answer: Stable in value

Explanation: I had put divisible but that wasn't correct.

John Maynard Keynes believed that the economy could be turned around and brought out of a depression by?

Answers

Answer:

Its not minimum wages its wrong and im not sure which one is the the answer but its not minimum wages

Explanation:

A small business loan is used to pay for the costs associated with starting your own company? True or false

Answers

Answer: True

Explanation:

A small business loan is known to be a loan given to an individual in order to start a business. The loan is used for running the day today activities of the business. The borrower that is the business owner reaches an agreement with the lender to repay the loan with interest over a specified period of time.

Answer:

TRUE

Explanation:

Loans are forms of financing entrepreneurial activities. Only entrepreneurial initiatives are the ones that most seek loans. Small businesses borrow money to cover the costs associated with starting up. For example, if you want to open an ice cream parlor but have no money, you can borrow from your bank to invest in your business.

which phrase best describes the income effect ?

A. the effect of demand and supply on income earned by producers

B. the impact of price on consumers' purchasing ability and decisions

C. the increased income earned by suppliers because of high prices

D. the impact of consumers' income on the supply of a product

Answers

The answer would be C) The increased income earned by suppliers because of high prices.
Final answer:

The income effect refers to the impact of changes in the price of goods on the purchasing power of a consumer's income, affecting consumption decisions.

Explanation:

The income effect can be defined by selection B: The impact of price on consumers' purchasing ability and decisions. The income effect is related to how changes in the price of a good influence the effective buying power of one's income. This doesn't refer to changes in actual income, but to the real quantities of goods that can be purchased with a fixed amount of income. As an example, if the price of a good that you have been buying falls, then in effect your buying power has risen, therefore you are able to purchase more goods. Conversely, if the price of a good that you have been buying rises, then the buying power of a given amount of income is diminished, thus potentially leading to less consumption of those goods.

Learn more about Income Effect here:

https://brainly.com/question/36277199

#SPJ2

Bridget has an outstanding balance on four different credit cards. Which method of paying off her credit card debt will save her the most money?

paying the minimum balance each month

making fixed payments

snowballing her payments according to the highest interest rate

snowballing her payments according to the lowest balance

Answers

snowballing her payments according to the highest interest rate or making fixed payments I'm not sure between those two

Answer:

The correct answer is "snowballing her payments according to the lowest balance".

Explanation:

The snowball method that prioritizes paying off the lowest debt first, regardless of the interest rate.

Debts must be ranked from lowest to highest and the minimum balance on each must be paid, except on the card with the lowest debt. For the lowest debt, you must pay as much money as possible each month until the total amount of debt is completed. Then you must move on to the second smallest debt and pay it off in that order.

Have a nice day!

What is the current value of a future sum of money called?

Answers

It seems that you have missed the necessary options for this question, but anyway, the correct answer for this would be PRESENT VALUE. The current value of a future sum of money is called a present value. Hope this is the answer that you are looking for. Have a great day!
Other Questions
Which of these is a complete sentence? (1 point) A. Starting at four o'clock.B. The theater where rehearsals take place..C. Stage hands, props, and lighting crew.D. Hannah memorized her lines. A number has the digit 8 and 4 .to the nearest 10.the number round to 50.what is the number? are fruit battery's good for the enviorment a landscaper estimates that a set of plants can be installed in six hours by 12 workers the landscaper wants to finish a set of plants in 4 hours assuming that the variables are inversely related how many workers should the landscaper bring to the job How did airports encourage city growth ?a. they promoted the building of hotels, restaurants,services and rapid transit to accommodate travelers b. they are so big and require so much land that they need a larger population to be sustained c. they limit the effects of gridlock and make travel more pleasantd. they were responsible for transporting over 13 billion tons of materials Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? Steam Workshop Downloader