You want to analyze a cadmium nitrate solution. what mass of naoh is needed to precipitate the cd2+ ions from 32.7 ml of 0.499 m cd(no3)2 solution?

Answers

Answer 1
First, we must know that in order to remove one mole of cadmium ions, we will require two moles of sodium ions. This is visible from the fact that the valence charge of cadmium ions is +2, while for sodium ions it is +1.

Next, we use the equation:

Moles = Molarity * Liters

We know that:

moles of sodium =  2 * moles of cadmium

Now, the moles of cadmium present are:
Moles = 0.499 * 0.0327 = 0.0163

The moles of NaOH required are double this, so:

Moles NaOH = 2 * 0.0163 = 0.0326

Mass = moles * molecular weight

Mass  = 0.0326 * 40
Mass = 1.304 grams of NaOH

Related Questions

Why is water considered a polar molecule?
a.the oxygen is found between the two hydrogens.
b.the oxygen atom attracts the hydrogen atoms.
c.the oxygen end of the molecule has a slight negative charge, and the hydrogen end has a slight positive charge.
d.both hydrogens are at one end of the molecule, and oxygen is at the other end?

Answers

B because The slight negative charge near the oxygen atom attracts nearby hydrogen atoms from water or positive-charged regions of other molecules.
The answer is B The oxygen atom attracts the hydrogen atoms. They work together, i just did this one.

Which form of investment has the most amount of risk involved?
savings account
checking account
mutual fund

Answers

Mutual fund, i think.

Answer:

mutual fund is a correct answer.

Explanation:

Mutual fund is a form of investment which has the most amount of risk involved.

In Mutual fund the most amount of risk involved are:

Market risk is there which causes losses of the investor if the performance of the market is not good.Management risk is there if there is any change in the management action and team, it can affect the price share of the company.Liquidity risk is there in the Mutual fund.

Thus Mutual fund has the most amount of risk involved.

How many electrons are required to complete the outer energy level of a phosphorus atom?

Answers

Phosphorus has 5 valence electrons
It wants a full octet for its outer shell

8-5 = 3

The number of electrons required to complete the outer energy level of the phosphorus atom has been 3.

Phosphorous has been Group 15 nonmetal. The atomic number of phosphorus has been 15.

The electronic configuration has been assigned to fill the subshells. The electronic configuration of Phosphorus has been:

2, 8, 5

The third shell of atoms has 8 electrons. In the third shell of phosphorus, the number of electrons is 5.

In order to complete the outer energy level, the number of electrons required are:

8 = 5 + electrons required

Electrons required = 8 - 5

Electrons required = 3

The number of electrons required to complete the outer energy level of the phosphorus atom has been 3.

For more information about outer energy level, refer to the link:

https://brainly.com/question/1663092

Derek needs a tool that delivers 25.00 mL of a sodium hydroxide solution. Which tool would be best for him to use? A. a beaker B.a pipette C.a graduated cylinder D.an Erlenmeyer flask

Answers

Answer:

B. a pipette

Explanation:

on edg 2021

In order for condensation to occur, air must be ________________ with water vapor.

Answers

h20 ix the la respuet

The light reactions of photosynthesis use _____ and produce _____. (activity 10b) nadph ... nadp+ water ... nadph carbon dioxide ... oxygen carbon dioxide ... sugar nadph ... oxygen

Answers

During the light reactions of photosynthesis, the energy from the sun is converted into few amounts of ATP and an energy carrier called NADPH. This is associated with the consumption of water and release of oxygen. So from the choices above, the correct answers are:

 

The light reactions of photosynthesis use water and produce nadph.

In an experiment, a student isolated 6.356 g of pure copper from an initial sample of 9.902 g of copper chloride. determine the empirical formula of this copper chloride compound. show your work.

Answers

The mass of the copper chloride is 9.902 g of which 6.356 is pure Copper, that makes 3.546 g Chloride. To determine the empirical formula you need to know that 1 mol of Cu is 63.54 g and 1 mol Cl is 35.45 g. 6.536/63.54= about .1 mol 3.546/35.45 is also about .1 mol so the empirical formula for this copper chloride would be CuCl

A molecule has four unshared electrons on the central atom and four chlorine atoms bonded to the central atom. What is its molecular shape and its hybridization?

Answers

Hybridization is the chemist's attempt to explain the observed molecular shape by constructing HAOs with the appropriate inter orbital angels. A molecule adopts its most stable shape all by itself ,then the chemist calculated what HAOs correspond to the shape.There is a One-to One correspondence between shape and hybridization.

Which two minerals are softer than a human finger nail
1)calcite and halite
2)sulfer and fluoriye
3)graphite and talc
4)pyrite and magnetlite

Answers

the answer is 1...................

The graphite and talc minerals are softer than a human fingernail. Therefore, option (3) is correct.

What is the hardness of minerals?

The hardness of a mineral measures its relative resistance to scratching,  by scratching the mineral against another substance whose hardness is known on the Mohs Hardness Scale.

The Mohs scale of mineral hardness is characterizing the scratch resistance of several minerals by measuring the ability of harder material to scratch softer material.

This method is useful for the identification of minerals in the field because we can test minerals against some common objects such as fingernails, pence, nails, etc. The scale is named behind the name of its creator the German mineralogist Friedrich Mohs.

The hardness of the fingernail is 2.5 while the hardness of the talc is 1 and the hardness of the graphite lies between 1 to 2. Therefore, graphite and talc are minerals that are softer than a human fingernail.

Learn more about the hardness of minerals, here:

https://brainly.com/question/13584611

#SPJ2

"Energy cannot be created or destroyed" is called the law of


renewability of energy


conservation of energy


conversion of energy


saving of energy

Answers

renew ability of energy is your answer

A 3.5-g sample of colorado oil shale is burned in a bomb calorimeter, which causes the temperature of the calorimeter to increase by 5.0°c. the calorimeter contains 1.00 kg of water (heat capacity of h2o = 4.184 j/g°c) and the heat capacity of the empty calorimeter is 0.10 kj/°c. how much heat is released per gram of oil shale when it is burned?

Answers

The amount of energy released when one gram of oil is burned is[tex]\boxed{{\text{6}}{\text{.12 kJ}}}[/tex].

Further explanation

Heat capacity is defined as the amount of heat required to change the temperature of a pure substance by one degree. Its S.I. unit is J/K.

Molar heat capacity is defined as the amount of heat required to raise the temperature of one mole of substance by one degree. Specific heat capacity is defined as the amount of heat needed to increase the temperature of 1 gram of a pure substance by one degree.

The expression to calculate amount of heat released or absorbed as follows:

[tex]{\text{q}}={\text{mC}}\Delta{\text{T}}[/tex]                                       …… (1)

Here, q is the amount of heat.

m is the mass of substance.

C is specific heat.

[tex]\Delta{\text{T}}[/tex]is change temperature.

Calorimeter is the device that measures the change in amount of heat absorbed or released during chemical reaction followed by change in temperature. Bomb calorimeter is the device which measure the amount of heat absorbed or released during chemical reaction at constant volume.

The formula to calculate the amount of heat change in calorimeter is as follows:

[tex]{{\text{q}}_{{\text{calorimeter}}}}={{\text{C}}_{{\text{calorimeter}}}}\times\Delta{{\text{T}}_{{\text{calorimeter}}}}[/tex]              …… (2)

The expression to calculate amount of heat absorbed by water is as follows:

[tex]{\text{q}}=\left({{{\text{m}}_{{\text{water}}}}}\right)\left({{{\text{C}}_{{\text{water}}}}}\right)\left({\Delta{\text{T}}}\right)[/tex]                                                …… (1)

Given, [tex]{{\text{C}}_{{\text{water}}}}[/tex] is 4.184 [tex]{\text{J/g}}\cdot^\circ{\text{C}}[/tex].

[tex]{{\text{m}}_{{\text{water}}}}[/tex]is 1 kg.

Change in temperature [tex]\left({\Delta{\text{T}}}\right)[/tex]is [tex]5\;^\circ{\text{C}}[/tex].

Substitute the value of [tex]{{\text{C}}_{{\text{water}}}}[/tex], [tex]{{\text{m}}_{{\text{water}}}}[/tex] and [tex]\Delta{\text{T}}[/tex]in equation (1).

[tex]\begin{aligned}{{\text{q}}_{{\text{water}}}}&=\left({{\text{1}}\;{\text{kg}}}\right)\left({\frac{{1000\;{\text{g}}}}{{{\text{1}}\;{\text{kg}}}}}\right)\left({\frac{{{\text{4}}{\text{.184 J}}}}{{{\text{g}}\cdot ^\circ{\text{C}}}}}\right)\left({5\;^\circ{\text{C}}}\right)\\&{\text{=20920 J}}\\\end{aligned}[/tex]

The amount of heat absorbed by water is 20920 J.

The value of [tex]{{\text{C}}_{{\text{calorimeter}}}}[/tex]is[tex]0.10\;{\text{kJ/}}^\circ{\text{C}}[/tex].

The value of [tex]\Delta{{\text{T}}_{{\text{calorimeter}}}}[/tex]is [tex]{5^\circ}{\text{C}}[/tex].

Substitute these values in equation (2).

[tex]\begin{aligned}{{\text{q}}_{{\text{calorimeter}}}}&=\left({\frac{{0.10\;{\text{kJ}}}}{{^\circ{\text{C}}}}}\right)\times 5\;^\circ{\text{C}}\\&={\text{0}}{\text{.50 kJ}}\\\end{aligned}[/tex]

Amount of heat absorbed by calorimeter is[tex]{\mathbf{0}}{\mathbf{.50 kJ}}[/tex].

The formula to calculate the total amount of heat released to burn 3.5 g of sample is as follows:

[tex]- {{\text{q}}_{{\text{rxn}}}}={{\text{q}}_{{\text{water}}}}+{{\text{q}}_{{\text{calorimeter}}}}[/tex]                   …… (3)

Substitute 20920 J for [tex]{{\text{q}}_{{\text{water}}}}[/tex] and 0.50 J for [tex]{{\text{q}}_{{\text{calorimeter}}}}[/tex] in equation (3)

[tex]\begin{aligned}-{{\text{q}}_{{\text{rxn}}}}&=20920{\text{ J}}+{\text{0}}{\text{.50 kJ}}\left({\frac{{1000\;{\text{J}}}}{{{\text{1}}\;{\text{kJ}}}}}\right)\\&={\text{21420 J}}\\\end{aligned}[/tex]

The total amount of energy released to burn 3.5 g of oil is 21420 J.

The amount of energy released to burn 1 g of oil is calculated as follows:

[tex]\begin{aligned}{\text{Energy released per gram}}&=\frac{{21420{\text{ J}}}}{{3.5{\text{ g}}}}\\&={\text{6120 J}}\\\end{aligned}[/tex]

The conversion factor to convert energy from J to kJ is as follows:

[tex]1{\text{ kJ}}={\text{1000}}\;{\text{J}}[/tex]

The amount of energy released after one gram of oil gets burned is calculated as follows:

[tex]\begin{aligned}{\text{Energy released per gram}}\left({{\text{kJ}}}\right)&=\left({{\text{1 kJ}}}\right)\left({\frac{{{\text{6120 J}}}}{{{\text{1000J}}}}}\right)\\&={\text{6}}{\text{.12 kJ}}\\\end{aligned}[/tex]

Hence, [tex]{\mathbf{6}}{\mathbf{.12 kJ}}[/tex] of energy is released when one gram of oil is burned.

Learn more:

1. Which is most likely a covalent compound https://brainly.com/question/2083444.

2. Calculate the pH of 0.1 m compoundhttps://brainly.com/question/2114744.

Answer details:

Grade: Senior school.

Subject: Chemistry.

Chapter: Thermodynamics

Keywords: Heat capacity, molar heat capacity, specific heat capacity, released, absorbed, calorimeter, bomb calorimeter, water, mass, temperature, degree, 6.12 kj, 6120 j, 0.50 and 2120 J.

The heat released per gram of oil shale is 6120 J/g.

To determine the heat released per gram of oil shale, calculate the heat absorbed by both the water and the calorimeter, then divide the total heat by the mass of the oil shale.

The heat released per gram of oil shale is 6120 J/g.

To determine how much heat is released per gram of oil shale when it is burned, follow these steps:

First, calculate the heat absorbed by the water.

The heat absorbed by the water (q water) can be calculated using the formula:qwater = mass * specific heat * ΔTHere, the mass of the water is 1000 g (since 1 kg = 1000 g), the specific heat of water is 4.184 J/g°C, and ΔT is the change in temperature (5.0°C).

Thus, q water = 1000 g * 4.184 J/g°C * 5.0°C = 20920 J.

Next, calculate the heat absorbed by the bomb calorimeter.

Since the calorimeter has a heat capacity of 0.10 kJ/°C, convert this to J/°C (1 kJ = 1000 J): 0.10 kJ/°C = 100 J/°C.

Then, calculate the heat (q calorimeter) absorbed by the calorimeter:

q calorimeter = heat capacity * ΔT = 100 J/°C * 5.0°C = 500 J.

Add the heat absorbed by the water and the calorimeter to get the total heat released by the combustion of the oil shale:

q total = q water + q calorimeterq total = 20920 J + 500 J = 21420 J.

Finally, determine the heat released per gram of oil shale by dividing the total heat by the mass of the oil shale:

Heat released per gram = q total / mass21420 J / 3.5 g = 6120 J/g.

Therefore, the heat released per gram of oil shale is 6120 J/g.

Correct question is: A 3.5-g sample of colorado oil shale is burned in a bomb calorimeter, which causes the temperature of the calorimeter to increase by 5.0°c. the calorimeter contains 1.00 kg of water (heat capacity of H₂O = 4.184 j/g°c) and the heat capacity of the empty calorimeter is 0.10 kj/°c. how much heat is released per gram of oil shale when it is burned?

Select all that apply to organic compounds. Organic compounds are only found in living things. Organic compounds can be synthesized in a laboratory setting. Organic compounds contain carbon. CO2 is an organic compound. There are hundreds of thousands of organic compounds.

Answers

Organic compounds are only found in living things, organic compounds contain carbon, CO2 is an organic compound,

Answer:

Correct options:

Organic compounds can be synthesized in a laboratory setting.

There are hundreds of thousands of organic compounds.

Explanation:

1) Organic compounds are only found in living things: False

Organic compounds are mainly carbon based. Although organic compounds are derived from living things like plants and animals, non-living things like sedimentary rocks are also rich in carbon.

2) Organic compounds can be synthesized in a laboratory setting: True

There are four major categories of organic compounds: carbohydrates, proteins, lipids and nucleic acids all of which can be synthesized in a laboratory.

3) Organic compounds contain carbon: False

Organic compounds are identified by the presence of both carbon and hydrogen (and sometimes other elements like O, N, S).

4)CO2 is an organic compound: False

There are no H atoms, hence CO2 is not organic.

5) There are hundreds of thousands of organic compounds: True

Assume that you had a mixture of solid na2co3 and nacl. could you use only h2so4 to determine whether na2co3 was present. explain.

Answers

The presence of sodium carbonate can be identified by adding some sulphuric acid. The carbonates will produce carbon dioxide and it can be identified by the brisk effervescence.

What is sodium carbonate?

Sodium carbonate is an inorganic compound formed from the sodium metal and carbonate ions. It is basic in nature due to the presence of electron  rich carbonate anion.

Sodium carbonate will reacts with acids and neutralise them to form salts. It is a weak acid and thus ionization and conductivity of its electrolyte are weak.

Sodium carbonate react with sulphuric acid gives carbon dioxide, water and sodium sulphate. The carbon dioxide formed there will evolves as gas and produce brisk effervescence.

Therefore, by the  brisk effervescence formed in the reaction we can identify the presence of sodium carbonate in the mixture.

To find more about sodium carbonate, refer the link below:

https://brainly.com/question/28901831

#SPJ5

A brick has dimensions of 25 cm x 5.0 cm x 15 cm. What is the volume of the brick in cubic meters?

Answers

the answer is 0.001875 cubic meters.

Explanation:

It is known that a brick has the shape of a rectangle. And formula to calculate the volume of a rectangle is as follows.

                     Volume of rectangle = length × height × width

Since, it is given that length is 25 cm, height is 5 cm and width is 15 cm. Therefore, calculate the volume of brick as follows.

                 Volume of brick = length × height × width

                                             = 25 cm × 5 cm × 15 cm

                                             = 1875 [tex]cm^{3}[/tex]

Hence, we can conclude that volume of the brick is 1875 [tex]cm^{3}[/tex].

A blood test shows clumps only in wells containing anti-A and anti-B antibodies. The Rhesus test was negative. Which is the correct blood type?
~ A-
~ B+
~ A+
~ AB-

Answers

Answer:

AB negative.

Explanation:

Four major types of blood group found in humans are A, B, AB and O. The rhesus factors determines whether the blood group is positive or negative. Karl Landsteiner explained the different types of blood group.

The blood test shows clumping in the wells with  anti-A and anti-B antibodies. The blood group is AB because AB blood group has both the antigens A and B, shows clumping in both the anti-A and anti-B antibodies. The rhesus test is negative indicates that the blood type is negative as the rhesus protein is absent on the surface of blood cells. Hence, the individual has AB- blood type.

Thus, the correct answer is option (4).

Answer:

AB -

Explanation:

took it

How are metals, metalloid and nonmetals separated on the periodic table?

Answers

Hi there,
The metals (green in the table), non metals (orange), and metalloid (blue).

Hope this helps :))

~Top

As temperature of this substance rises from 20°C to 50°C, the substance _______ heat and its kinetic energy _________ .
A) absorbs; increases
B) releases; increases
C) absorbs; remains constant
D) remains constant; increases

Answers

Hello!

I think the answer to this question would be A) Absorbs; Increases.

I hope this is correct, and it helps you out! c:

Answer: Option (A) is the correct answer.

Explanation:

When a substance absorbs heat energy then there will occur an increase in the temperature of the substance.

And, as there is occurring an increase in the temperature of substance. Kinetic energy is related to temperature as follows.

                   [tex]K.E \propto \frac{3}{2}kT[/tex]

Hence, with increase in temperature there will also be increase in kinetic energy of the molecules of a substance.

Thus, we can conclude that as temperature of this substance rises from [tex]20^{o}C[/tex] to [tex]50^{o}C[/tex], the substance absorbs heat and its kinetic energy increases.

. Using the following equation: F = ma Solve for m (1 point)

Answers

To solve for m in the equation F = ma, you must divide both side of the equation by a. This will make the equation look like F/a = ma/a. Since m is being multiplied by a, dividing it will cancel out. Now making the final equation look like F/a=m and/or m=F/a.

What physically breaks hydrogen bonds between water molecules as ice melts? what physically breaks hydrogen bonds between water molecules as ice melts? covalent bonds of water molecules movement of water molecules mass of water molecules polarity of water molecules?

Answers

Movement of water molecules breaks the hydrogen bond between water molecules when ice melts. This is because heat energy is added to ice in order for it to melt, so the water molecules start moving at a faster rate.
Final answer:

Hydrogen bonds between water molecules are broken when ice melts as a result of increased kinetic energy of the water molecules, which comes with increased temperature. As the water molecules move past each other, the hydrogen bonds are naturally broken. Conversely, these bonds remain intact as water freezes, contributing to the less dense nature of ice compared to liquid water.

Explanation:

In the process of ice melting, the hydrogen bonds between water molecules are broken due to the kinetic energy of the water molecules, which increases as the temperature increases. The water molecules move and slide past each other, causing the bonds to break.

Hydrogen bonds regularly form and break in liquid water, but when the temperature drops and water freezes, a crystalline structure is formed, which is maintained by hydrogen bonding as there is not enough energy to break these bonds. This characteristic makes ice less dense than liquid water, an unusual property when compared to other liquids.

Learn more about Hydrogen Bonds here:

https://brainly.com/question/30885458

#SPJ12

How many milliliters of 0.120 m naoh are required to titrate 50.0 ml of 0.0998 m benzoic acid to the equivalence point? the ka of benzoic acid is 6.3 ⋅ 10-5?

Answers

To reach the equivalence point in the titration of 50.0 mL of 0.0998 M benzoic acid with 0.120 M NaOH, 41.58 mL of NaOH is required.

The student is asking how to calculate the volume of 0.120 M NaOH required to neutralize a given volume and concentration of benzoic acid in a titration process. Since benzoic acid is a monoprotic acid, it will react with NaOH in a 1:1 mole ratio.

To solve this, we use the formula:

molarity of acid (Macid) imes volume of acid (Vacid) = molarity of base (Mbase) imes volume of base (Vbase)

Substitute the known values into the equation to find the unknown volume of NaOH:

Macid = 0.0998 M

Vacid = 50.0 mL

Mbase = 0.120 M

Vbase = ?

Rearrange the equation to solve for Vbase:

Vbase = (Macid x Vacid) / Mbase

Vbase = (0.0998 M x 50.0 mL) / 0.120 M

Vbase = 41.58 mL

Therefore, 41.58 mL of 0.120 M NaOH is required to reach the equivalence point in the titration of 50.0 mL of 0.0998 M benzoic acid.

Express in scientific notation. Make sure your answer has the same number of significant figures as the starting value. 61,103 = _____ 6.11 x 10 4 6.1103 x 10 4 6 x 10 4

Answers

Final answer:

To express 87,449 in scientific notation with four significant figures, it's written as 8.745 × 104. The number 0.000066600 in scientific notation with five significant figures is expressed as 6.6600 × 10-5.

Explanation:

To express the number 87,449 in scientific notation with four significant figures, you need to place the decimal after the first digit and count the number of places you move it. In this case, the decimal is moved 4 places to the left: 8.7449 becomes 8.744. Now, we need just four significant figures, so it rounds to 8.745. This gives us 8.745 × 10 to the power of 4, or 8.745 × 104.

Writing the number 0.000066600 in scientific notation with five significant figures involves moving the decimal point 5 places to the right, giving us 6.6600 which rounds to 6.6600 with five significant figures. This becomes 6.6600 × 10 to the negative fifth power, or 6.6600 × 10-5.

What is the term for a liquid composed of polar molecules?

Answers

A dissolving liquid composed of polar molecules is a polar solvent.

The distinction of polar and non-polar liquids is important because the like dissolves like rule. This rule states that the solubility is greater when the polarity of the liquid is similar to the polarity of the solute.

So, to dissolve polar compounds (e.g. ionic compounds) you should use polar solvents (e.g. water).

Answer: polar solvent

If neon were frozen into the solid state, would it still be a substance?

Answers

Yes it would still be a substance bc when a glow stick is frozen after cracked it saves the neon chemical for when you need it, in general preserving it.

What is the pH of a 0.025 M [OH−] solution?

0.94

1.60

9.60

12.40

Answers

You can use the pOH to solve for the pH.

pOH = -log([OH-])
14 = pH + pOH

The pH of 0.025 M [OH-] solution would be 12.4

pH

The pH is the degree of acidity or alkalinity of a substance.

Mathematically,

pH = 14 - pOH

pH = -log [H+]

pOH = -log [OH-]

In this case, [OH-] = 0.025 M

Thus

pOH = -log [OH-]

           = -log 0.025

              = 1.6

pH = 14 - 1.6

       = 12.4

More on pH can be found here: https://brainly.com/question/491373

Which of these elements would have the lowest first ionization energy?

Answers

Among the elements listed, potassium (K) would have the lowest first ionization energy.

The element with the lowest first ionization energy is potassium (K). In general, elements in group 1A of the periodic table, also known as alkali metals, have the lowest first ionization energies.

This is due to their electron configuration, which features a single valence electron in the outermost shell, held relatively loosely due to the shielding effect of inner electrons and the large atomic size.

As a result, it requires less energy to remove this outer electron compared to other elements. Potassium, located in group 1A, has an atomic number of 19 and exhibits this characteristic exceptionally well.

Therefore, among the elements listed, potassium (K) would have the lowest first ionization energy.

Complete question :-

Which element has the lowest first ionization energy?
a) As
b) P
c) K
d) Bi
e) Sb

Staples and metal shavings are examples of which type of hazards

Answers

They are examples of physical contaminants .

Staples and metal shavings are types of Staples and metal shavings are types of physical hazards.

What are physical hazards?

These are the types of hazards that can be possible by some contamination such as metal shavings getting into food staples are also a form of physical hazard caused by foreign contamination also.

It is a type of hazard which cause pain and harm to the human body and animals too.

They can be caused by food too like the small metal pieces that can enter our system through the food and goes to our alimentary canal as they cannot be digested and cause major infection in the human body. Which can also affect the immune system of the body

They get entry to the food pipe goes into the small intestine and large intestine as they interfere with the metabolism of the digestive system and cause  many more problems

They affect the biochemical reactions of the body like protein synthesis and all of which can lead to loss of motion and many infectious diseases

Therefore, is it a  physical hazard

Learn more about physical hazards, here:

https://brainly.com/question/7310653

#SPJ6

A gas is most likely to exist at which of the following conditions?
High temperatures and high pressures
High temperatures and low pressures
Low temperatures and high pressures
Low temperatures and low pressures

Answers

High temperatures and low pressure. Low pressure, most of the time, is correlated with high temperatures.

Hope this helps!

Answer: Option (b) is the correct answer.

Explanation:

When we heat a solid substance at high temperature then it changes into liquid state and then into gaseous state.

For example, when water is heated above 100 degree celsius then it changes into vapors.

When low pressure is provided to a gas then its molecules are able to move easily from one place to another.

Therefore, a gas is most likely to exist at high temperature and low pressure.

According to the equation below, what is the enthalpy change when 400.0 g of propane is burned in excess oxygen? c3h8 (g) + 5o2 (g) ) ↔ 3co2 (g) + 4h2o (l) δh = -2221kj

Answers

The heat released by one mole of propane gas is given, -2221 kJ. Thus 400 g or 9 moles of propane gas will release - 20190 kJ of heat energy.

What is combustion?

Combustion is the reaction of a substance with atmospheric oxygen to produce water and carbon dioxide. The process release heat energy since combustion reactions are exothermic.

It is given that one mole of propane gas produces - 2221 kJ.

molar mass = 44 g/mol

number of moles in 400 g = 400 /44 = 9 moles.

One mole of propane gas when combines with excess oxygen produces - 2221 kJ of energy. Hence, heat released by 9 moles is calculated as follows:

The heat released from 9 moles = 9 ×  - 2221 kJ = - 20190 kJ.

Therefore, enthalpy change in the combustion of 400 g of propane is - - 20190 kJ.

To find more on combustion, refer here:

https://brainly.com/question/15117038

#SPJ2

What happens when an electric field is applied to a very polar molecule?

Answers

The polar molecules aligned due to the non-zero net electric force that creates a torque. Although alignment may not be perfect.

Final answer:

Polar molecules align themselves in an electric field, with their positive ends facing the negative plate and their negative ends facing the positive plate, to maximize attraction between opposite charges.

Explanation:

Response to Polar Molecules in an Electric Field

When an electric field is applied to a very polar molecule, the molecules will align themselves with the field. A polar molecule has a permanent dipole moment due to an uneven distribution of positive and negative charges. In the absence of an electric field, these molecules are randomly oriented, and thus have no net effect. However, in the presence of an electric field, they orient themselves so that the positive end of each molecule is attracted to the negative plate, and the negative end is attracted to the positive plate. This alignment occurs because polar molecules want to maximize the attraction between opposite charges induced by the electric field, effectively creating a net dipole moment density per unit volume.

Polar molecules like HF will align to their dipoles with the field direction, demonstrating this behavior. The same effect can be observed with nonpolar molecules; while they do not have a permanent dipole moment, they can acquire an induced electric-dipole moment when subjected to an electric field, which also aligns with the field direction.

Describe how you would prepare a supersaturated solution of lithium sulfate

Answers

Most sulfates are insoluble except for Group 1A elements. Hence, lithium sulfate is soluble in water. In order to make a supersaturated solution, add solid lithium sulfate in any amount of water. Then, stir. Don't stop adding until some of it will be left undissolved. Once particles settle and doesn't dissolve no matter how much you stir, heat the solution while adding more of the lithium sulfate. When it dissolves all of the solute, you have now created a supersaturated solution.
Other Questions
John Adams Alien and Sedition Acts influenced the election of 1800 because can someone plz help me. Which of the following best describes the Battle of Britain? A. The bombardment of northern France to prepare for a British invasion of continental Europe B. The German sea landing on the southern coast of Britain C. An air battle above the English Channel to prepare for an invasion of Britain D. The sea battle between German U-boats and British battleships Why did the united states get involved in the korean war? what was the outcome of the war? By establishing this link between the levels of cooperation observed in _____ with local forest conditions, rustagi et al. have increased the confidence that scholars can have in the external validity of results from previous experiments carried out all over the world, with student and nonstudent subjects. Refer to landing service. because the company is known for its ability to produce lawn furniture more efficiently than any other company in the world, the company must have a(n) ____ advantage. If the mass of an object increases, the force acting on it, such as gravitational force, also increases. A manufacturer wants to implement a trade sales promotion. Which of the following would apply?A. Offering retail stores a 10% discount on their productsB. Offering mail-in rebates to consumers who purchase their productsC. Distributing coupons through newspapers for "buy one get one free" offers on their productsD. Purchasing television ads that promote the enhanced style of their products why did the catholic church feel threatened by the heliocentric theory of the universe A subway ride for a student costs $1.25. A monthly pass costs $35.Write an inequality that represents the number of times, x , you must ride the subway for the monthly pass to be a better deal. 10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer Steam Workshop Downloader